Incidental Mutation 'R5851:Slc6a19'
ID454690
Institutional Source Beutler Lab
Gene Symbol Slc6a19
Ensembl Gene ENSMUSG00000021565
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 19
SynonymsB<0>AT1, 4632401C08Rik
MMRRC Submission 044067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5851 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location73679745-73704865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73691740 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 141 (F141S)
Ref Sequence ENSEMBL: ENSMUSP00000022048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022048] [ENSMUST00000124406]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022048
AA Change: F141S

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022048
Gene: ENSMUSG00000021565
AA Change: F141S

DomainStartEndE-ValueType
Pfam:SNF 32 608 2.3e-180 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123997
Predicted Effect probably benign
Transcript: ENSMUST00000124406
SMART Domains Protein: ENSMUSP00000119313
Gene: ENSMUSG00000021565

DomainStartEndE-ValueType
Pfam:SNF 32 79 1.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140878
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a system B(0) transmembrane protein that actively transports most neutral amino acids across the apical membrane of epithelial cells. Mutations in this gene result in Hartnup disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and impaired amino acid absorption and excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930404N11Rik A T 10: 81,364,877 probably null Het
Abca2 A G 2: 25,442,310 N1452D possibly damaging Het
Abhd15 T C 11: 77,518,447 L329P probably benign Het
Add3 T C 19: 53,236,774 S442P probably damaging Het
Arhgef18 T C 8: 3,434,980 F228L probably damaging Het
Bptf A T 11: 107,110,862 Y475N probably damaging Het
C3 T C 17: 57,211,612 N1257S probably null Het
Ccdc94 C T 17: 55,967,582 S298F probably damaging Het
Cd163l1 C T 7: 140,228,027 P704S possibly damaging Het
Cdkl1 A T 12: 69,756,564 Y179* probably null Het
Ceacam1 T C 7: 25,474,600 N210S possibly damaging Het
Celf3 T A 3: 94,479,126 I7N probably damaging Het
Cmpk1 A G 4: 114,986,970 V55A possibly damaging Het
Csrnp1 C T 9: 119,973,078 G305D possibly damaging Het
Dnah3 A G 7: 120,039,362 S1266P possibly damaging Het
Edc4 T C 8: 105,890,867 L1077P probably damaging Het
Efcab1 T A 16: 14,920,436 L155H probably damaging Het
Fam174a G A 1: 95,325,143 G157S probably damaging Het
Fubp3 T A 2: 31,598,610 D159E probably benign Het
Garem2 C T 5: 30,114,290 T250M probably damaging Het
H2-Eb1 C T 17: 34,309,771 P92L probably benign Het
Ifnl3 G T 7: 28,523,511 C69F probably damaging Het
Itga2b C A 11: 102,457,601 probably benign Het
Klhl33 A T 14: 50,892,878 D386E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lor G A 3: 92,080,539 A480V unknown Het
Msh3 G T 13: 92,215,522 Q1041K probably benign Het
Myo1e G A 9: 70,383,804 G959E probably benign Het
Nfat5 G T 8: 107,347,727 V338L probably damaging Het
Nrf1 A G 6: 30,089,976 H18R possibly damaging Het
Nup160 A G 2: 90,707,038 D752G probably benign Het
Obscn A T 11: 58,994,700 L2489* probably null Het
Olfr1184 A G 2: 88,486,860 I43V possibly damaging Het
Olfr638 A G 7: 104,003,452 E59G probably benign Het
Paip1 T C 13: 119,440,765 S215P possibly damaging Het
Pate2 T A 9: 35,670,501 Y26* probably null Het
Pcdhb10 A G 18: 37,412,758 I296V probably benign Het
Pdzph1 T G 17: 58,973,746 T514P probably benign Het
Pnlip G A 19: 58,673,792 W123* probably null Het
Prmt2 C A 10: 76,236,740 C9F possibly damaging Het
Rbl1 T A 2: 157,167,325 K763N probably benign Het
Rfk C T 19: 17,395,198 A28V probably damaging Het
Sdk1 G A 5: 141,962,669 V590I probably benign Het
Sele A G 1: 164,049,574 K140E probably benign Het
Skiv2l2 G A 13: 112,908,952 R349W probably damaging Het
Sla G A 15: 66,783,723 T189I probably damaging Het
Slc46a2 A G 4: 59,913,906 V339A probably damaging Het
Slc5a9 A G 4: 111,885,600 F432L probably benign Het
Tas2r123 T C 6: 132,847,308 L56S probably damaging Het
Tmem245 T C 4: 56,916,770 I53V probably benign Het
Tor2a A T 2: 32,761,607 Q278L probably benign Het
Trav6-3 A G 14: 53,430,115 M15V probably benign Het
Ttc28 G A 5: 111,235,469 probably benign Het
Ubap2 G A 4: 41,206,268 Q534* probably null Het
Zfp954 C A 7: 7,115,625 E307* probably null Het
Zscan21 A G 5: 138,126,478 K219E probably benign Het
Other mutations in Slc6a19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02401:Slc6a19 APN 13 73700590 missense probably damaging 1.00
IGL02425:Slc6a19 APN 13 73691800 missense probably benign 0.00
IGL03030:Slc6a19 APN 13 73700471 missense probably damaging 1.00
IGL03067:Slc6a19 APN 13 73689730 nonsense probably null
IGL03216:Slc6a19 APN 13 73686181 missense probably benign
IGL03330:Slc6a19 APN 13 73689560 missense possibly damaging 0.95
H8562:Slc6a19 UTSW 13 73700124 intron probably benign
R0107:Slc6a19 UTSW 13 73684057 missense possibly damaging 0.93
R0446:Slc6a19 UTSW 13 73691695 missense probably benign 0.01
R1422:Slc6a19 UTSW 13 73685869 missense probably benign 0.05
R1443:Slc6a19 UTSW 13 73684344 missense probably damaging 1.00
R1501:Slc6a19 UTSW 13 73684048 missense probably benign 0.08
R1564:Slc6a19 UTSW 13 73686124 missense probably damaging 1.00
R1632:Slc6a19 UTSW 13 73689908 splice site probably null
R1832:Slc6a19 UTSW 13 73692950 missense probably benign
R2077:Slc6a19 UTSW 13 73700566 missense probably benign
R4418:Slc6a19 UTSW 13 73684395 missense possibly damaging 0.93
R4486:Slc6a19 UTSW 13 73681717 missense probably damaging 0.98
R4510:Slc6a19 UTSW 13 73683975 missense probably damaging 1.00
R4511:Slc6a19 UTSW 13 73683975 missense probably damaging 1.00
R4803:Slc6a19 UTSW 13 73684042 missense possibly damaging 0.91
R4965:Slc6a19 UTSW 13 73700558 missense probably benign 0.00
R4988:Slc6a19 UTSW 13 73685840 nonsense probably null
R5085:Slc6a19 UTSW 13 73691753 missense probably benign 0.11
R5533:Slc6a19 UTSW 13 73685829 missense possibly damaging 0.67
R5874:Slc6a19 UTSW 13 73684368 missense probably damaging 0.98
R6074:Slc6a19 UTSW 13 73689763 missense probably benign 0.00
R6608:Slc6a19 UTSW 13 73683972 missense probably damaging 1.00
R7275:Slc6a19 UTSW 13 73686078 missense probably benign 0.11
R7386:Slc6a19 UTSW 13 73689891 missense possibly damaging 0.91
R7388:Slc6a19 UTSW 13 73693084 missense probably benign 0.30
R7393:Slc6a19 UTSW 13 73692974 missense probably benign 0.00
Z1088:Slc6a19 UTSW 13 73689730 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCACAAGGTCTAAGAAGTTGCC -3'
(R):5'- TATCTGCTCTTCAGGTCGGG -3'

Sequencing Primer
(F):5'- GCCAGCAACCATTTCTTCCAC -3'
(R):5'- AGCAGGCCCTTCCCAATGTC -3'
Posted On2017-02-10