Incidental Mutation 'R5852:Tti1'
ID454714
Institutional Source Beutler Lab
Gene Symbol Tti1
Ensembl Gene ENSMUSG00000027650
Gene NameTELO2 interacting protein 1
Synonyms2610036D13Rik
MMRRC Submission 043227-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R5852 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location157981803-158028433 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 158000673 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 812 (L812P)
Ref Sequence ENSEMBL: ENSMUSP00000105148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029179] [ENSMUST00000109522]
Predicted Effect probably damaging
Transcript: ENSMUST00000029179
AA Change: L812P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029179
Gene: ENSMUSG00000027650
AA Change: L812P

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 306 319 N/A INTRINSIC
low complexity region 401 411 N/A INTRINSIC
low complexity region 494 504 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
SCOP:d1gw5a_ 855 1044 3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109522
AA Change: L812P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105148
Gene: ENSMUSG00000027650
AA Change: L812P

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 306 319 N/A INTRINSIC
low complexity region 401 411 N/A INTRINSIC
low complexity region 494 504 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
SCOP:d1gw5a_ 855 1044 3e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126541
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,927,404 I453F probably damaging Het
Anpep C T 7: 79,838,972 W402* probably null Het
Apcdd1 T C 18: 62,937,063 S134P probably damaging Het
Cbwd1 A G 19: 24,955,405 V88A possibly damaging Het
Ccdc154 T C 17: 25,163,209 V34A probably benign Het
Cntn3 A T 6: 102,420,416 N65K probably damaging Het
Cntn6 G T 6: 104,835,745 V663F probably damaging Het
Crisp3 A T 17: 40,225,820 C201* probably null Het
Dnhd1 T A 7: 105,695,748 W2100R probably damaging Het
Dync2h1 A T 9: 7,011,290 S3634R probably benign Het
Fam189a1 T A 7: 64,775,831 H171L probably damaging Het
Gucy1a2 T C 9: 3,865,460 F645L probably damaging Het
Hs6st3 G T 14: 119,869,326 R382L probably damaging Het
Il27 T A 7: 126,592,614 T89S possibly damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Klhl23 T A 2: 69,824,269 I161N probably benign Het
Lrrk2 G A 15: 91,755,949 E1566K probably damaging Het
Mia3 A G 1: 183,332,859 V437A probably benign Het
Ncoa6 G T 2: 155,405,499 H1962N possibly damaging Het
Nox4 C T 7: 87,338,964 T361I probably damaging Het
Pappa2 T C 1: 158,717,014 Y1748C probably damaging Het
Phyhip T C 14: 70,461,929 probably null Het
Pkhd1 A G 1: 20,377,408 F2254L probably benign Het
Plxnb1 A G 9: 109,106,450 Y1018C probably damaging Het
Pnoc C T 14: 65,411,222 V8I probably benign Het
Prss29 A G 17: 25,322,434 D256G probably benign Het
Scrn3 T C 2: 73,331,005 F312L probably damaging Het
Sephs1 A G 2: 4,899,528 E239G possibly damaging Het
Wdr1 A G 5: 38,537,175 S62P probably benign Het
Zfp106 A G 2: 120,516,006 S1659P probably damaging Het
Other mutations in Tti1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Tti1 APN 2 158008966 missense probably damaging 1.00
IGL00434:Tti1 APN 2 158008965 missense probably damaging 1.00
IGL00820:Tti1 APN 2 158008968 missense probably damaging 1.00
IGL00949:Tti1 APN 2 157982399 missense probably benign 0.00
IGL01080:Tti1 APN 2 157982459 missense probably damaging 1.00
IGL01084:Tti1 APN 2 157982459 missense probably damaging 1.00
IGL01339:Tti1 APN 2 158009130 missense possibly damaging 0.80
IGL01685:Tti1 APN 2 158000785 missense probably benign 0.01
IGL01866:Tti1 APN 2 158007698 missense probably benign 0.27
IGL01903:Tti1 APN 2 158000622 missense probably benign 0.01
IGL03142:Tti1 APN 2 158000677 missense probably damaging 0.99
IGL03173:Tti1 APN 2 158007012 unclassified probably benign
IGL03385:Tti1 APN 2 157993025 missense possibly damaging 0.86
R0413:Tti1 UTSW 2 157995476 missense probably benign 0.00
R0601:Tti1 UTSW 2 157993372 missense probably damaging 0.99
R1718:Tti1 UTSW 2 158008224 missense probably benign 0.40
R1760:Tti1 UTSW 2 157993035 missense possibly damaging 0.87
R1761:Tti1 UTSW 2 158007697 missense probably benign 0.01
R1968:Tti1 UTSW 2 158009046 missense possibly damaging 0.66
R2054:Tti1 UTSW 2 158007445 missense possibly damaging 0.79
R2131:Tti1 UTSW 2 158000743 missense probably benign
R3886:Tti1 UTSW 2 158008950 missense possibly damaging 0.74
R4479:Tti1 UTSW 2 158008395 missense possibly damaging 0.95
R4647:Tti1 UTSW 2 158007020 unclassified probably benign
R5124:Tti1 UTSW 2 158008195 missense probably damaging 0.99
R5145:Tti1 UTSW 2 158008512 missense probably benign 0.30
R6667:Tti1 UTSW 2 158008427 nonsense probably null
R6714:Tti1 UTSW 2 158007051 missense possibly damaging 0.73
R6719:Tti1 UTSW 2 157982300 missense probably benign 0.01
R7143:Tti1 UTSW 2 158007676 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAACCATGTGAAAACTCTGTTTTG -3'
(R):5'- ATGCCAGTCTTGCCAAAGAG -3'

Sequencing Primer
(F):5'- CTGGAAGCAGTTTACACACACATATG -3'
(R):5'- GCCAGTCTTGCCAAAGAGCTTAATC -3'
Posted On2017-02-10