Incidental Mutation 'R5852:Prss29'
ID454735
Institutional Source Beutler Lab
Gene Symbol Prss29
Ensembl Gene ENSMUSG00000034039
Gene Nameprotease, serine 29
SynonymsIsp2, mISP-2
MMRRC Submission 043227-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5852 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25318654-25322681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25322434 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 256 (D256G)
Ref Sequence ENSEMBL: ENSMUSP00000024993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024993]
Predicted Effect probably benign
Transcript: ENSMUST00000024993
AA Change: D256G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000024993
Gene: ENSMUSG00000034039
AA Change: D256G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 30 271 7.11e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182525
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,927,404 I453F probably damaging Het
Anpep C T 7: 79,838,972 W402* probably null Het
Apcdd1 T C 18: 62,937,063 S134P probably damaging Het
Cbwd1 A G 19: 24,955,405 V88A possibly damaging Het
Ccdc154 T C 17: 25,163,209 V34A probably benign Het
Cntn3 A T 6: 102,420,416 N65K probably damaging Het
Cntn6 G T 6: 104,835,745 V663F probably damaging Het
Crisp3 A T 17: 40,225,820 C201* probably null Het
Dnhd1 T A 7: 105,695,748 W2100R probably damaging Het
Dync2h1 A T 9: 7,011,290 S3634R probably benign Het
Fam189a1 T A 7: 64,775,831 H171L probably damaging Het
Gucy1a2 T C 9: 3,865,460 F645L probably damaging Het
Hs6st3 G T 14: 119,869,326 R382L probably damaging Het
Il27 T A 7: 126,592,614 T89S possibly damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Klhl23 T A 2: 69,824,269 I161N probably benign Het
Lrrk2 G A 15: 91,755,949 E1566K probably damaging Het
Mia3 A G 1: 183,332,859 V437A probably benign Het
Ncoa6 G T 2: 155,405,499 H1962N possibly damaging Het
Nox4 C T 7: 87,338,964 T361I probably damaging Het
Pappa2 T C 1: 158,717,014 Y1748C probably damaging Het
Phyhip T C 14: 70,461,929 probably null Het
Pkhd1 A G 1: 20,377,408 F2254L probably benign Het
Plxnb1 A G 9: 109,106,450 Y1018C probably damaging Het
Pnoc C T 14: 65,411,222 V8I probably benign Het
Scrn3 T C 2: 73,331,005 F312L probably damaging Het
Sephs1 A G 2: 4,899,528 E239G possibly damaging Het
Tti1 A G 2: 158,000,673 L812P probably damaging Het
Wdr1 A G 5: 38,537,175 S62P probably benign Het
Zfp106 A G 2: 120,516,006 S1659P probably damaging Het
Other mutations in Prss29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Prss29 APN 17 25322133 missense probably benign 0.05
IGL01619:Prss29 APN 17 25321139 critical splice donor site probably null
IGL01670:Prss29 APN 17 25322463 missense probably benign 0.03
IGL02516:Prss29 APN 17 25320901 missense probably damaging 1.00
R1538:Prss29 UTSW 17 25320283 start codon destroyed possibly damaging 0.93
R4285:Prss29 UTSW 17 25322257 missense probably damaging 1.00
R5148:Prss29 UTSW 17 25320907 missense probably benign 0.00
R5468:Prss29 UTSW 17 25321046 missense possibly damaging 0.95
R5483:Prss29 UTSW 17 25322203 missense probably benign 0.00
R6226:Prss29 UTSW 17 25320539 missense possibly damaging 0.74
R6346:Prss29 UTSW 17 25321110 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGGCCAGAAACTGATCCTAAAGG -3'
(R):5'- TGGTCACCTACACTCCAGAG -3'

Sequencing Primer
(F):5'- CATGTTATGTGCAGGCAACC -3'
(R):5'- AGAGCCTAAACCCTGGCCG -3'
Posted On2017-02-10