Incidental Mutation 'R5853:Slc44a1'
ID454752
Institutional Source Beutler Lab
Gene Symbol Slc44a1
Ensembl Gene ENSMUSG00000028412
Gene Namesolute carrier family 44, member 1
SynonymsCdw92, 4833416H08Rik, CHTL1, CTL1, 2210409B22Rik
MMRRC Submission 044068-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5853 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location53440413-53622478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 53528682 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 144 (K144T)
Ref Sequence ENSEMBL: ENSMUSP00000103274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102911] [ENSMUST00000107646] [ENSMUST00000107647] [ENSMUST00000107651]
Predicted Effect probably benign
Transcript: ENSMUST00000102911
AA Change: K144T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099975
Gene: ENSMUSG00000028412
AA Change: K144T

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 290 610 2.4e-107 PFAM
low complexity region 630 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107646
AA Change: K144T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103273
Gene: ENSMUSG00000028412
AA Change: K144T

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 290 500 4.9e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107647
AA Change: K144T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103274
Gene: ENSMUSG00000028412
AA Change: K144T

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 292 607 1.8e-105 PFAM
low complexity region 630 643 N/A INTRINSIC
transmembrane domain 682 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107651
AA Change: K144T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103278
Gene: ENSMUSG00000028412
AA Change: K144T

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 290 610 3.5e-108 PFAM
low complexity region 630 643 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136607
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 G A 7: 120,340,583 V303I probably benign Het
Abca4 G T 3: 122,103,531 V620L probably benign Het
Ankk1 A T 9: 49,418,695 V320E possibly damaging Het
Aoah G T 13: 20,999,902 A379S probably benign Het
Apol7e A G 15: 77,714,467 D44G probably benign Het
Atf2 T C 2: 73,828,469 probably null Het
Cd209b T C 8: 3,926,549 probably null Het
Chek1 G A 9: 36,713,687 S366L probably damaging Het
Chpf2 T C 5: 24,592,192 L712P probably damaging Het
Clmn C A 12: 104,783,902 probably null Het
Cnksr3 T C 10: 7,142,977 D178G probably benign Het
Cpox T C 16: 58,675,417 Y366H probably damaging Het
Dnah3 A G 7: 119,938,833 F3632S probably damaging Het
Eif5b T A 1: 38,037,307 D645E probably damaging Het
Emilin1 G A 5: 30,918,622 E736K probably damaging Het
Gcnt4 G A 13: 96,946,652 R152Q probably benign Het
Il6st T C 13: 112,481,537 S162P probably damaging Het
Iqub T C 6: 24,491,602 K362E probably benign Het
Kif22 G T 7: 127,033,367 P257Q possibly damaging Het
Lhx2 T C 2: 38,369,041 V378A probably damaging Het
Lipo1 A G 19: 33,782,230 V202A probably benign Het
Lrp1b T A 2: 40,663,726 N366I unknown Het
Mbip T C 12: 56,335,877 D268G probably damaging Het
Mc5r A G 18: 68,339,493 M308V probably benign Het
Mndal C A 1: 173,862,504 G420V probably damaging Het
Nbea A T 3: 55,992,401 N1442K probably damaging Het
Ndufv1 A T 19: 4,008,811 probably null Het
Ofcc1 A G 13: 40,206,717 S279P probably benign Het
Olfr1415 T C 1: 92,491,717 I13V probably benign Het
Olfr730 A T 14: 50,186,869 M116K possibly damaging Het
Pabpc1l A T 2: 164,049,518 H552L probably benign Het
Pigr T A 1: 130,846,604 C440* probably null Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Prss30 C T 17: 23,972,846 V271I probably damaging Het
Psme4 T A 11: 30,791,234 probably null Het
Qrich1 T A 9: 108,533,608 probably benign Het
Rem1 C G 2: 152,628,280 A62G possibly damaging Het
Rftn1 T C 17: 50,047,326 N58S probably damaging Het
Rp9 G A 9: 22,448,769 probably benign Het
Rrp1b G A 17: 32,056,684 V402I possibly damaging Het
Slc25a33 A T 4: 149,753,892 Y108N probably benign Het
Slc3a1 A G 17: 85,032,580 M189V probably damaging Het
Tbc1d13 T A 2: 30,137,381 H100Q probably damaging Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tmem70 T C 1: 16,665,332 W9R possibly damaging Het
Tspan1 A G 4: 116,163,305 probably null Het
Unc13a T C 8: 71,655,129 probably null Het
Uroc1 T C 6: 90,346,756 F395S probably damaging Het
Uvrag A C 7: 98,888,077 L637R possibly damaging Het
Vmn1r213 T G 13: 23,011,514 L3W probably benign Het
Zfp280d C T 9: 72,330,942 T528I probably benign Het
Zfp526 C T 7: 25,225,176 Q287* probably null Het
Other mutations in Slc44a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc44a1 APN 4 53543571 missense probably damaging 1.00
IGL00420:Slc44a1 APN 4 53553550 missense possibly damaging 0.86
IGL01369:Slc44a1 APN 4 53491448 missense probably damaging 1.00
IGL01867:Slc44a1 APN 4 53536405 missense probably damaging 1.00
IGL02188:Slc44a1 APN 4 53541361 missense probably benign 0.01
IGL03095:Slc44a1 APN 4 53536374 nonsense probably null
R0517:Slc44a1 UTSW 4 53542366 missense probably damaging 0.99
R0815:Slc44a1 UTSW 4 53536421 missense possibly damaging 0.77
R1437:Slc44a1 UTSW 4 53561006 missense probably damaging 1.00
R1443:Slc44a1 UTSW 4 53561069 missense probably damaging 1.00
R1673:Slc44a1 UTSW 4 53542468 missense probably benign 0.04
R2037:Slc44a1 UTSW 4 53563243 intron probably benign
R2131:Slc44a1 UTSW 4 53563246 frame shift probably null
R3417:Slc44a1 UTSW 4 53553549 missense probably benign 0.04
R3721:Slc44a1 UTSW 4 53491445 missense probably damaging 1.00
R3763:Slc44a1 UTSW 4 53563286 missense probably benign 0.45
R4426:Slc44a1 UTSW 4 53563286 missense probably benign 0.45
R4751:Slc44a1 UTSW 4 53560973 missense probably damaging 1.00
R4993:Slc44a1 UTSW 4 53543644 missense probably damaging 1.00
R6293:Slc44a1 UTSW 4 53561099 missense probably damaging 1.00
R6978:Slc44a1 UTSW 4 53544671 missense probably damaging 1.00
R7164:Slc44a1 UTSW 4 53528711 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTGCCTAAAGTCCATTAAATTGTGG -3'
(R):5'- ATGGTTATCAAGGATGCCCCAG -3'

Sequencing Primer
(F):5'- TGTGGATCATTTCAGAGAAAAGTG -3'
(R):5'- TTATCAAGGATGCCCCAGTGACAG -3'
Posted On2017-02-10