Incidental Mutation 'R5854:Gtf3c3'
ID454797
Institutional Source Beutler Lab
Gene Symbol Gtf3c3
Ensembl Gene ENSMUSG00000041303
Gene Namegeneral transcription factor IIIC, polypeptide 3
Synonyms
MMRRC Submission 043228-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5854 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location54396004-54438971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 54419437 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 442 (A442S)
Ref Sequence ENSEMBL: ENSMUSP00000039420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041638]
Predicted Effect probably benign
Transcript: ENSMUST00000041638
AA Change: A442S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000039420
Gene: ENSMUSG00000041303
AA Change: A442S

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
low complexity region 92 108 N/A INTRINSIC
TPR 145 178 9.24e1 SMART
TPR 179 212 2.36e1 SMART
TPR 213 246 4.58e-4 SMART
TPR 247 280 6.4e1 SMART
Blast:TPR 286 319 6e-9 BLAST
low complexity region 353 365 N/A INTRINSIC
TPR 452 485 1.87e1 SMART
low complexity region 549 560 N/A INTRINSIC
TPR 807 840 3.27e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190419
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atg4c G A 4: 99,228,559 V313I probably benign Het
Ccdc18 A G 5: 108,206,728 E1111G possibly damaging Het
Chuk T C 19: 44,081,957 H573R probably benign Het
Cst13 A G 2: 148,828,174 N88S probably benign Het
Dalrd3 T C 9: 108,570,077 probably null Het
Dnah8 T A 17: 30,794,763 M3826K possibly damaging Het
Dsp A G 13: 38,167,501 probably null Het
Fbxo41 A G 6: 85,475,094 L810P probably damaging Het
Fcrlb T C 1: 170,907,961 Y248C probably damaging Het
Gmcl1 A G 6: 86,714,259 silent Het
Hdac4 T C 1: 91,959,421 S799G probably damaging Het
Hnrnpa2b1 C G 6: 51,466,609 probably benign Het
Hnrnpab T C 11: 51,604,681 E177G probably damaging Het
Knl1 A G 2: 119,070,403 I862V probably benign Het
Lonp2 T A 8: 86,673,071 probably null Het
Map3k19 G T 1: 127,830,355 P363T probably damaging Het
Morn3 A G 5: 123,041,115 Y91H probably damaging Het
Myom2 A G 8: 15,108,478 D810G probably benign Het
Nans A G 4: 46,500,180 Y188C probably damaging Het
Ndufs1 A T 1: 63,147,389 D1E probably benign Het
Nelfb T C 2: 25,209,993 N204S probably damaging Het
Noxo1 T C 17: 24,698,542 S31P probably damaging Het
Olfr312 T A 11: 58,831,556 M134K probably damaging Het
Olfr53 A G 7: 140,652,578 M200V probably benign Het
Olfr914 T C 9: 38,606,663 L66S probably damaging Het
Pkd1l2 T G 8: 117,065,746 T436P possibly damaging Het
Pkhd1l1 A G 15: 44,581,790 D3686G probably damaging Het
Ppp2r5b A G 19: 6,230,944 L285S probably damaging Het
Pzp A T 6: 128,506,869 V522D probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rpe65 A G 3: 159,615,676 D375G probably benign Het
Sacs C T 14: 61,211,547 L3681F probably damaging Het
Sft2d1 C T 17: 8,320,653 T96I probably damaging Het
Slc12a7 A G 13: 73,793,940 N312D probably benign Het
Spaca6 A T 17: 17,831,247 K82* probably null Het
Stk32c A G 7: 139,188,279 probably benign Het
Tet2 T A 3: 133,487,885 N263Y probably damaging Het
Uxs1 T C 1: 43,780,073 N190S probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Gtf3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Gtf3c3 APN 1 54415955 missense probably damaging 0.99
IGL00435:Gtf3c3 APN 1 54427535 missense possibly damaging 0.73
IGL01128:Gtf3c3 APN 1 54428876 missense possibly damaging 0.91
R0243:Gtf3c3 UTSW 1 54403536 missense possibly damaging 0.60
R0271:Gtf3c3 UTSW 1 54428812 missense possibly damaging 0.96
R0571:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0965:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0968:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1069:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1070:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1111:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1112:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1113:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1114:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1115:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1117:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1118:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1119:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1228:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1230:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1231:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1382:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1394:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1395:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1397:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1414:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1430:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1432:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1473:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1497:Gtf3c3 UTSW 1 54437939 missense probably benign
R1556:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1563:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1638:Gtf3c3 UTSW 1 54405119 missense probably damaging 1.00
R1695:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1716:Gtf3c3 UTSW 1 54399260 missense probably damaging 1.00
R1745:Gtf3c3 UTSW 1 54434212 missense probably damaging 1.00
R1767:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1799:Gtf3c3 UTSW 1 54420424 missense possibly damaging 0.82
R1861:Gtf3c3 UTSW 1 54438838 missense possibly damaging 0.87
R1940:Gtf3c3 UTSW 1 54428958 splice site probably benign
R3804:Gtf3c3 UTSW 1 54424007 critical splice donor site probably null
R4496:Gtf3c3 UTSW 1 54424132 missense probably benign 0.03
R4621:Gtf3c3 UTSW 1 54419416 missense probably damaging 1.00
R5131:Gtf3c3 UTSW 1 54419498 synonymous probably null
R5320:Gtf3c3 UTSW 1 54405873 missense probably damaging 1.00
R5605:Gtf3c3 UTSW 1 54415926 missense probably benign 0.06
R6050:Gtf3c3 UTSW 1 54406070 missense probably benign 0.00
R6441:Gtf3c3 UTSW 1 54406038 missense probably benign 0.03
R6892:Gtf3c3 UTSW 1 54415941 missense probably benign 0.00
R7114:Gtf3c3 UTSW 1 54423507 missense probably benign
R7299:Gtf3c3 UTSW 1 54417708 missense probably benign 0.01
R7441:Gtf3c3 UTSW 1 54420448 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCACTCAGTAGTCTGGCAAG -3'
(R):5'- TGCTTCCTGGCTTATGTCAG -3'

Sequencing Primer
(F):5'- CGTGCTGGGAACATAAACT -3'
(R):5'- GGCTTATGTCAGGTAGCTGATAAAC -3'
Posted On2017-02-10