Mutagenetix > Incidental Mutation

Incidental Mutation 'R5854:Knl1'

454805

Institutional Source

Beutler Lab

Gene Symbol

Knl1

Ensembl Gene

ENSMUSG00000027326

Gene Name

kinetochore scaffold 1

Synonyms

Casc5, 2310043D08Rik, 5730505K17Rik

MMRRC Submission

043228-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5854 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118877600-118935982 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118900884 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 862 (I862V)

Ref Sequence

ENSEMBL: ENSMUSP00000028799 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380] [ENSMUST00000153300]

AlphaFold

Q66JQ7

Predicted Effect

probably benign
Transcript: ENSMUST00000028799
AA Change: I862V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: I862V

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	1e-13	PDB
low complexity region	426	433	N/A	INTRINSIC
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000028802
AA Change: I862V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: I862V

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000099542
AA Change: I862V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: I862V

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000152380

SMART Domains

Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	3e-14	PDB
low complexity region	426	433	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153300

SMART Domains

Protein: ENSMUSP00000120905
Gene: ENSMUSG00000027326

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,786,596 (GRCm39)	I7M	unknown	Het
Abca8b	C	A	11: 109,868,639 (GRCm39)	G175V	probably damaging	Het
Atg4c	G	A	4: 99,116,796 (GRCm39)	V313I	probably benign	Het
Ccdc18	A	G	5: 108,354,594 (GRCm39)	E1111G	possibly damaging	Het
Chuk	T	C	19: 44,070,396 (GRCm39)	H573R	probably benign	Het
Cst13	A	G	2: 148,670,094 (GRCm39)	N88S	probably benign	Het
Dalrd3	T	C	9: 108,447,276 (GRCm39)		probably null	Het
Dnah8	T	A	17: 31,013,737 (GRCm39)	M3826K	possibly damaging	Het
Dsp	A	G	13: 38,351,477 (GRCm39)		probably null	Het
Fbxo41	A	G	6: 85,452,076 (GRCm39)	L810P	probably damaging	Het
Fcrlb	T	C	1: 170,735,530 (GRCm39)	Y248C	probably damaging	Het
Gmcl1	A	G	6: 86,691,241 (GRCm39)		silent	Het
Gtf3c3	C	A	1: 54,458,596 (GRCm39)	A442S	probably benign	Het
Hdac4	T	C	1: 91,887,143 (GRCm39)	S799G	probably damaging	Het
Hnrnpa2b1	C	G	6: 51,443,589 (GRCm39)		probably benign	Het
Hnrnpab	T	C	11: 51,495,508 (GRCm39)	E177G	probably damaging	Het
Lonp2	T	A	8: 87,399,699 (GRCm39)		probably null	Het
Map3k19	G	T	1: 127,758,092 (GRCm39)	P363T	probably damaging	Het
Morn3	A	G	5: 123,179,178 (GRCm39)	Y91H	probably damaging	Het
Myom2	A	G	8: 15,158,478 (GRCm39)	D810G	probably benign	Het
Nans	A	G	4: 46,500,180 (GRCm39)	Y188C	probably damaging	Het
Ndufs1	A	T	1: 63,186,548 (GRCm39)	D1E	probably benign	Het
Nelfb	T	C	2: 25,100,005 (GRCm39)	N204S	probably damaging	Het
Noxo1	T	C	17: 24,917,516 (GRCm39)	S31P	probably damaging	Het
Or13a20	A	G	7: 140,232,491 (GRCm39)	M200V	probably benign	Het
Or5af1	T	A	11: 58,722,382 (GRCm39)	M134K	probably damaging	Het
Or8b50	T	C	9: 38,517,959 (GRCm39)	L66S	probably damaging	Het
Pkd1l2	T	G	8: 117,792,485 (GRCm39)	T436P	possibly damaging	Het
Pkhd1l1	A	G	15: 44,445,186 (GRCm39)	D3686G	probably damaging	Het
Ppp2r5b	A	G	19: 6,280,974 (GRCm39)	L285S	probably damaging	Het
Pzp	A	T	6: 128,483,832 (GRCm39)	V522D	probably benign	Het
Rictor	G	A	15: 6,823,487 (GRCm39)	E1555K	probably benign	Het
Rpe65	A	G	3: 159,321,313 (GRCm39)	D375G	probably benign	Het
Sacs	C	T	14: 61,448,996 (GRCm39)	L3681F	probably damaging	Het
Sft2d1	C	T	17: 8,539,485 (GRCm39)	T96I	probably damaging	Het
Slc12a7	A	G	13: 73,942,059 (GRCm39)	N312D	probably benign	Het
Spaca6	A	T	17: 18,051,509 (GRCm39)	K82*	probably null	Het
Stk32c	A	G	7: 138,768,195 (GRCm39)		probably benign	Het
Tet2	T	A	3: 133,193,646 (GRCm39)	N263Y	probably damaging	Het
Uxs1	T	C	1: 43,819,233 (GRCm39)	N190S	probably damaging	Het
Zfp703	C	T	8: 27,469,233 (GRCm39)	P299L	probably damaging	Het

Other mutations in Knl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Knl1	APN	2	118,894,564 (GRCm39)	missense	probably damaging	0.96
IGL00582:Knl1	APN	2	118,932,980 (GRCm39)	missense	probably benign	0.19
IGL00666:Knl1	APN	2	118,900,945 (GRCm39)	missense	probably damaging	0.96
IGL01062:Knl1	APN	2	118,907,461 (GRCm39)	missense	probably benign	0.33
IGL01395:Knl1	APN	2	118,902,047 (GRCm39)	missense	probably damaging	0.96
IGL01604:Knl1	APN	2	118,900,482 (GRCm39)	missense	probably damaging	1.00
IGL01996:Knl1	APN	2	118,934,542 (GRCm39)	missense	probably damaging	1.00
IGL02086:Knl1	APN	2	118,931,255 (GRCm39)	missense	probably benign	0.40
IGL02105:Knl1	APN	2	118,902,289 (GRCm39)	missense	probably benign
IGL02106:Knl1	APN	2	118,902,489 (GRCm39)	missense	possibly damaging	0.89
IGL02201:Knl1	APN	2	118,899,633 (GRCm39)	missense	probably benign	0.01
IGL02252:Knl1	APN	2	118,903,021 (GRCm39)	missense	probably damaging	1.00
IGL02414:Knl1	APN	2	118,900,804 (GRCm39)	missense	possibly damaging	0.83
IGL02655:Knl1	APN	2	118,901,473 (GRCm39)	missense	possibly damaging	0.62
IGL02682:Knl1	APN	2	118,908,450 (GRCm39)	missense	possibly damaging	0.86
IGL02710:Knl1	APN	2	118,901,411 (GRCm39)	missense	probably damaging	0.99
IGL02877:Knl1	APN	2	118,919,312 (GRCm39)	missense	probably benign	0.08
IGL03100:Knl1	APN	2	118,931,251 (GRCm39)	missense	probably damaging	0.99
IGL03210:Knl1	APN	2	118,901,098 (GRCm39)	missense	probably benign	0.02
IGL03138:Knl1	UTSW	2	118,902,840 (GRCm39)	missense	probably damaging	0.96
R0023:Knl1	UTSW	2	118,933,030 (GRCm39)	missense	possibly damaging	0.73
R0064:Knl1	UTSW	2	118,906,724 (GRCm39)	missense	probably benign	0.00
R0064:Knl1	UTSW	2	118,906,724 (GRCm39)	missense	probably benign	0.00
R0078:Knl1	UTSW	2	118,900,373 (GRCm39)	missense	probably benign	0.16
R0178:Knl1	UTSW	2	118,888,886 (GRCm39)	splice site	probably benign
R0295:Knl1	UTSW	2	118,919,320 (GRCm39)	missense	probably damaging	1.00
R0433:Knl1	UTSW	2	118,934,542 (GRCm39)	missense	probably damaging	0.96
R0453:Knl1	UTSW	2	118,898,869 (GRCm39)	missense	probably damaging	1.00
R0569:Knl1	UTSW	2	118,927,916 (GRCm39)	missense	possibly damaging	0.95
R0827:Knl1	UTSW	2	118,919,382 (GRCm39)	splice site	probably benign
R0920:Knl1	UTSW	2	118,900,309 (GRCm39)	missense	probably benign	0.00
R1120:Knl1	UTSW	2	118,892,856 (GRCm39)	missense	probably damaging	0.99
R1155:Knl1	UTSW	2	118,901,635 (GRCm39)	missense	possibly damaging	0.90
R1204:Knl1	UTSW	2	118,901,670 (GRCm39)	missense	probably benign	0.00
R1241:Knl1	UTSW	2	118,903,054 (GRCm39)	missense	probably benign	0.03
R1387:Knl1	UTSW	2	118,901,211 (GRCm39)	missense	possibly damaging	0.93
R1448:Knl1	UTSW	2	118,898,788 (GRCm39)	missense	probably damaging	1.00
R1469:Knl1	UTSW	2	118,901,827 (GRCm39)	missense	possibly damaging	0.73
R1469:Knl1	UTSW	2	118,901,827 (GRCm39)	missense	possibly damaging	0.73
R1719:Knl1	UTSW	2	118,902,219 (GRCm39)	missense	probably benign	0.01
R1721:Knl1	UTSW	2	118,906,815 (GRCm39)	missense	probably damaging	1.00
R2128:Knl1	UTSW	2	118,902,300 (GRCm39)	missense	possibly damaging	0.79
R2170:Knl1	UTSW	2	118,918,075 (GRCm39)	critical splice donor site	probably null
R2227:Knl1	UTSW	2	118,902,481 (GRCm39)	missense	probably damaging	0.97
R2246:Knl1	UTSW	2	118,902,708 (GRCm39)	missense	probably damaging	1.00
R2275:Knl1	UTSW	2	118,902,762 (GRCm39)	missense	probably damaging	0.99
R2508:Knl1	UTSW	2	118,888,849 (GRCm39)	nonsense	probably null
R3115:Knl1	UTSW	2	118,900,872 (GRCm39)	missense	possibly damaging	0.53
R3122:Knl1	UTSW	2	118,899,425 (GRCm39)	missense	probably benign	0.32
R3431:Knl1	UTSW	2	118,892,843 (GRCm39)	missense	probably damaging	1.00
R3755:Knl1	UTSW	2	118,933,060 (GRCm39)	missense	probably damaging	1.00
R4461:Knl1	UTSW	2	118,890,080 (GRCm39)	missense	probably benign	0.00
R4600:Knl1	UTSW	2	118,901,025 (GRCm39)	missense	possibly damaging	0.90
R4713:Knl1	UTSW	2	118,899,618 (GRCm39)	nonsense	probably null
R4758:Knl1	UTSW	2	118,902,213 (GRCm39)	frame shift	probably null
R4762:Knl1	UTSW	2	118,902,417 (GRCm39)	missense	probably benign	0.01
R4869:Knl1	UTSW	2	118,902,832 (GRCm39)	missense	possibly damaging	0.73
R4870:Knl1	UTSW	2	118,911,994 (GRCm39)	missense	probably benign	0.22
R4935:Knl1	UTSW	2	118,899,438 (GRCm39)	missense	possibly damaging	0.50
R5167:Knl1	UTSW	2	118,900,512 (GRCm39)	missense	probably damaging	1.00
R5184:Knl1	UTSW	2	118,899,657 (GRCm39)	missense	probably damaging	1.00
R5293:Knl1	UTSW	2	118,900,176 (GRCm39)	missense	probably damaging	0.99
R5326:Knl1	UTSW	2	118,898,829 (GRCm39)	missense	possibly damaging	0.66
R5331:Knl1	UTSW	2	118,900,736 (GRCm39)	missense	possibly damaging	0.92
R5353:Knl1	UTSW	2	118,901,464 (GRCm39)	missense	probably benign	0.01
R5493:Knl1	UTSW	2	118,899,211 (GRCm39)	missense	probably damaging	0.98
R5542:Knl1	UTSW	2	118,898,829 (GRCm39)	missense	possibly damaging	0.66
R5632:Knl1	UTSW	2	118,900,833 (GRCm39)	missense	probably damaging	1.00
R5650:Knl1	UTSW	2	118,912,031 (GRCm39)	nonsense	probably null
R5979:Knl1	UTSW	2	118,899,841 (GRCm39)	missense	possibly damaging	0.83
R6086:Knl1	UTSW	2	118,924,549 (GRCm39)	missense	probably damaging	1.00
R6283:Knl1	UTSW	2	118,900,767 (GRCm39)	missense	probably damaging	1.00
R6285:Knl1	UTSW	2	118,902,422 (GRCm39)	missense	probably damaging	1.00
R6313:Knl1	UTSW	2	118,899,799 (GRCm39)	missense	probably damaging	1.00
R6419:Knl1	UTSW	2	118,899,484 (GRCm39)	missense	probably benign	0.02
R6608:Knl1	UTSW	2	118,917,093 (GRCm39)	missense	probably damaging	0.99
R6881:Knl1	UTSW	2	118,925,665 (GRCm39)	missense	possibly damaging	0.67
R7161:Knl1	UTSW	2	118,901,266 (GRCm39)	missense	possibly damaging	0.79
R7206:Knl1	UTSW	2	118,899,780 (GRCm39)	missense	probably benign	0.35
R7270:Knl1	UTSW	2	118,933,003 (GRCm39)	missense	possibly damaging	0.53
R7276:Knl1	UTSW	2	118,902,167 (GRCm39)	missense	probably damaging	0.98
R7358:Knl1	UTSW	2	118,901,040 (GRCm39)	missense	possibly damaging	0.92
R7402:Knl1	UTSW	2	118,925,707 (GRCm39)	nonsense	probably null
R7408:Knl1	UTSW	2	118,901,073 (GRCm39)	missense	possibly damaging	0.54
R7475:Knl1	UTSW	2	118,918,027 (GRCm39)	missense	probably damaging	1.00
R7516:Knl1	UTSW	2	118,901,179 (GRCm39)	missense	probably damaging	0.99
R7524:Knl1	UTSW	2	118,896,460 (GRCm39)	missense	probably damaging	1.00
R7559:Knl1	UTSW	2	118,924,487 (GRCm39)	missense	possibly damaging	0.84
R7607:Knl1	UTSW	2	118,925,614 (GRCm39)	missense	possibly damaging	0.93
R7745:Knl1	UTSW	2	118,902,037 (GRCm39)	missense	probably benign	0.13
R7847:Knl1	UTSW	2	118,901,457 (GRCm39)	missense	probably benign	0.02
R8423:Knl1	UTSW	2	118,900,513 (GRCm39)	missense	probably damaging	1.00
R8725:Knl1	UTSW	2	118,899,524 (GRCm39)	missense	probably benign	0.34
R8727:Knl1	UTSW	2	118,899,524 (GRCm39)	missense	probably benign	0.34
R8995:Knl1	UTSW	2	118,902,990 (GRCm39)	missense	probably benign	0.11
R9023:Knl1	UTSW	2	118,900,761 (GRCm39)	missense	probably benign	0.27
R9100:Knl1	UTSW	2	118,899,469 (GRCm39)	missense	probably benign	0.02
R9102:Knl1	UTSW	2	118,917,973 (GRCm39)	missense	probably benign	0.22
R9303:Knl1	UTSW	2	118,898,829 (GRCm39)	missense	possibly damaging	0.83
R9400:Knl1	UTSW	2	118,931,224 (GRCm39)	missense	probably damaging	0.98
R9426:Knl1	UTSW	2	118,899,979 (GRCm39)	missense	possibly damaging	0.81
R9583:Knl1	UTSW	2	118,887,782 (GRCm39)	missense	probably damaging	1.00
R9616:Knl1	UTSW	2	118,907,425 (GRCm39)	missense	probably damaging	1.00
R9616:Knl1	UTSW	2	118,899,994 (GRCm39)	missense	probably benign	0.02
R9671:Knl1	UTSW	2	118,901,089 (GRCm39)	missense	probably damaging	1.00
R9766:Knl1	UTSW	2	118,900,381 (GRCm39)	missense	probably damaging	1.00
R9782:Knl1	UTSW	2	118,899,910 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AACTCCTGGTGATCTGGATAAGAC -3'
(R):5'- GCAGAACTCTGAGGGATCTCTC -3'

Sequencing Primer
(F):5'- GGTGATCTGGATAAGACTATGATGTC -3'
(R):5'- GAACTCTGAGGGATCTCTCTATAAC -3'

Posted On

2017-02-10