Incidental Mutation 'R5854:Ccdc18'
ID454813
Institutional Source Beutler Lab
Gene Symbol Ccdc18
Ensembl Gene ENSMUSG00000056531
Gene Namecoiled-coil domain containing 18
Synonyms4932411G06Rik, 1700021E15Rik
MMRRC Submission 043228-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5854 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108132875-108233628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108206728 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1111 (E1111G)
Ref Sequence ENSEMBL: ENSMUSP00000036507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047677]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047677
AA Change: E1111G

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531
AA Change: E1111G

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
coiled coil region 168 320 N/A INTRINSIC
coiled coil region 344 405 N/A INTRINSIC
coiled coil region 507 1307 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199594
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atg4c G A 4: 99,228,559 V313I probably benign Het
Chuk T C 19: 44,081,957 H573R probably benign Het
Cst13 A G 2: 148,828,174 N88S probably benign Het
Dalrd3 T C 9: 108,570,077 probably null Het
Dnah8 T A 17: 30,794,763 M3826K possibly damaging Het
Dsp A G 13: 38,167,501 probably null Het
Fbxo41 A G 6: 85,475,094 L810P probably damaging Het
Fcrlb T C 1: 170,907,961 Y248C probably damaging Het
Gmcl1 A G 6: 86,714,259 silent Het
Gtf3c3 C A 1: 54,419,437 A442S probably benign Het
Hdac4 T C 1: 91,959,421 S799G probably damaging Het
Hnrnpa2b1 C G 6: 51,466,609 probably benign Het
Hnrnpab T C 11: 51,604,681 E177G probably damaging Het
Knl1 A G 2: 119,070,403 I862V probably benign Het
Lonp2 T A 8: 86,673,071 probably null Het
Map3k19 G T 1: 127,830,355 P363T probably damaging Het
Morn3 A G 5: 123,041,115 Y91H probably damaging Het
Myom2 A G 8: 15,108,478 D810G probably benign Het
Nans A G 4: 46,500,180 Y188C probably damaging Het
Ndufs1 A T 1: 63,147,389 D1E probably benign Het
Nelfb T C 2: 25,209,993 N204S probably damaging Het
Noxo1 T C 17: 24,698,542 S31P probably damaging Het
Olfr312 T A 11: 58,831,556 M134K probably damaging Het
Olfr53 A G 7: 140,652,578 M200V probably benign Het
Olfr914 T C 9: 38,606,663 L66S probably damaging Het
Pkd1l2 T G 8: 117,065,746 T436P possibly damaging Het
Pkhd1l1 A G 15: 44,581,790 D3686G probably damaging Het
Ppp2r5b A G 19: 6,230,944 L285S probably damaging Het
Pzp A T 6: 128,506,869 V522D probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rpe65 A G 3: 159,615,676 D375G probably benign Het
Sacs C T 14: 61,211,547 L3681F probably damaging Het
Sft2d1 C T 17: 8,320,653 T96I probably damaging Het
Slc12a7 A G 13: 73,793,940 N312D probably benign Het
Spaca6 A T 17: 17,831,247 K82* probably null Het
Stk32c A G 7: 139,188,279 probably benign Het
Tet2 T A 3: 133,487,885 N263Y probably damaging Het
Uxs1 T C 1: 43,780,073 N190S probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Ccdc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ccdc18 APN 5 108180525 missense probably benign 0.01
IGL01380:Ccdc18 APN 5 108180887 missense probably damaging 0.96
IGL01405:Ccdc18 APN 5 108202186 splice site probably benign
IGL01718:Ccdc18 APN 5 108201348 missense possibly damaging 0.81
IGL02098:Ccdc18 APN 5 108202111 missense probably damaging 1.00
IGL02227:Ccdc18 APN 5 108148922 missense possibly damaging 0.89
IGL02391:Ccdc18 APN 5 108136052 missense probably damaging 1.00
IGL02794:Ccdc18 APN 5 108171748 missense probably benign 0.00
IGL02808:Ccdc18 APN 5 108135969 splice site probably benign
IGL02880:Ccdc18 APN 5 108135444 missense probably benign 0.31
IGL03069:Ccdc18 APN 5 108228901 missense probably damaging 1.00
IGL03390:Ccdc18 APN 5 108212131 missense probably damaging 1.00
PIT4402001:Ccdc18 UTSW 5 108158619 missense possibly damaging 0.94
R0004:Ccdc18 UTSW 5 108161700 missense possibly damaging 0.52
R0112:Ccdc18 UTSW 5 108173761 missense probably damaging 1.00
R0295:Ccdc18 UTSW 5 108173789 missense probably damaging 1.00
R0546:Ccdc18 UTSW 5 108174964 missense probably benign 0.06
R0619:Ccdc18 UTSW 5 108180416 missense probably benign 0.04
R0648:Ccdc18 UTSW 5 108135560 missense probably damaging 0.99
R0648:Ccdc18 UTSW 5 108174987 missense probably damaging 1.00
R0666:Ccdc18 UTSW 5 108163664 missense probably benign 0.19
R1271:Ccdc18 UTSW 5 108202116 nonsense probably null
R1509:Ccdc18 UTSW 5 108188978 missense possibly damaging 0.89
R1539:Ccdc18 UTSW 5 108191977 missense probably damaging 1.00
R1542:Ccdc18 UTSW 5 108212188 missense probably benign
R1663:Ccdc18 UTSW 5 108216090 missense probably damaging 1.00
R1865:Ccdc18 UTSW 5 108193802 missense probably benign 0.00
R1870:Ccdc18 UTSW 5 108220837 missense possibly damaging 0.90
R1897:Ccdc18 UTSW 5 108196042 missense probably benign 0.00
R1946:Ccdc18 UTSW 5 108228995 missense probably damaging 1.00
R2420:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2421:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2422:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R4078:Ccdc18 UTSW 5 108158528 nonsense probably null
R4079:Ccdc18 UTSW 5 108158528 nonsense probably null
R4244:Ccdc18 UTSW 5 108148972 nonsense probably null
R4409:Ccdc18 UTSW 5 108220842 nonsense probably null
R4428:Ccdc18 UTSW 5 108136077 missense probably benign 0.01
R4455:Ccdc18 UTSW 5 108161529 missense possibly damaging 0.68
R4499:Ccdc18 UTSW 5 108228960 missense possibly damaging 0.62
R4612:Ccdc18 UTSW 5 108135441 missense probably benign 0.01
R4907:Ccdc18 UTSW 5 108136141 missense probably benign 0.01
R4972:Ccdc18 UTSW 5 108192003 missense probably benign
R5039:Ccdc18 UTSW 5 108158648 critical splice donor site probably null
R5835:Ccdc18 UTSW 5 108140874 missense possibly damaging 0.94
R6128:Ccdc18 UTSW 5 108163759 missense possibly damaging 0.76
R6229:Ccdc18 UTSW 5 108171618 missense probably benign 0.00
R6271:Ccdc18 UTSW 5 108174887 missense possibly damaging 0.65
R6315:Ccdc18 UTSW 5 108161582 missense probably benign
R6359:Ccdc18 UTSW 5 108135525 missense probably damaging 1.00
R6375:Ccdc18 UTSW 5 108174954 missense possibly damaging 0.79
R6388:Ccdc18 UTSW 5 108201348 missense possibly damaging 0.81
R6415:Ccdc18 UTSW 5 108161746 missense probably benign 0.03
R6560:Ccdc18 UTSW 5 108191924 missense probably benign 0.09
R6645:Ccdc18 UTSW 5 108138930 missense probably benign
R6664:Ccdc18 UTSW 5 108168100 nonsense probably null
R6836:Ccdc18 UTSW 5 108197967 missense probably damaging 1.00
R6947:Ccdc18 UTSW 5 108161535 missense probably benign 0.26
R7009:Ccdc18 UTSW 5 108173862 critical splice donor site probably null
R7052:Ccdc18 UTSW 5 108161688 missense probably benign 0.15
R7058:Ccdc18 UTSW 5 108193798 missense probably benign
R7087:Ccdc18 UTSW 5 108196122 missense probably benign
R7117:Ccdc18 UTSW 5 108148969 missense possibly damaging 0.95
R7176:Ccdc18 UTSW 5 108168106 missense probably benign
R7382:Ccdc18 UTSW 5 108139007 missense probably damaging 1.00
R7477:Ccdc18 UTSW 5 108220850 missense probably damaging 0.98
X0024:Ccdc18 UTSW 5 108191922 missense probably benign 0.01
X0063:Ccdc18 UTSW 5 108212197 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTTGCCTTAAAAGATACCTCT -3'
(R):5'- CTTGCCCATATCAAAACCAGAATAAT -3'

Sequencing Primer
(F):5'- GCTTCAACCTCTAAAATGCTGGG -3'
(R):5'- CTTAGAGCACAGTTTCTGTATT -3'
Posted On2017-02-10