Incidental Mutation 'R5854:Olfr53'
ID454821
Institutional Source Beutler Lab
Gene Symbol Olfr53
Ensembl Gene ENSMUSG00000094819
Gene Nameolfactory receptor 53
SynonymsGA_x6K02T2PBJ9-42798103-42799038, IE12, MOR253-5
MMRRC Submission 043228-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5854 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140646452-140653085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140652578 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 200 (M200V)
Ref Sequence ENSEMBL: ENSMUSP00000081494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084456] [ENSMUST00000211057] [ENSMUST00000211399]
Predicted Effect probably benign
Transcript: ENSMUST00000084456
AA Change: M200V

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000081494
Gene: ENSMUSG00000094819
AA Change: M200V

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.5e-51 PFAM
Pfam:7TM_GPCR_Srsx 37 208 9.7e-7 PFAM
Pfam:7tm_1 43 292 1.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211057
Predicted Effect probably benign
Transcript: ENSMUST00000211399
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atg4c G A 4: 99,228,559 V313I probably benign Het
Ccdc18 A G 5: 108,206,728 E1111G possibly damaging Het
Chuk T C 19: 44,081,957 H573R probably benign Het
Cst13 A G 2: 148,828,174 N88S probably benign Het
Dalrd3 T C 9: 108,570,077 probably null Het
Dnah8 T A 17: 30,794,763 M3826K possibly damaging Het
Dsp A G 13: 38,167,501 probably null Het
Fbxo41 A G 6: 85,475,094 L810P probably damaging Het
Fcrlb T C 1: 170,907,961 Y248C probably damaging Het
Gmcl1 A G 6: 86,714,259 silent Het
Gtf3c3 C A 1: 54,419,437 A442S probably benign Het
Hdac4 T C 1: 91,959,421 S799G probably damaging Het
Hnrnpa2b1 C G 6: 51,466,609 probably benign Het
Hnrnpab T C 11: 51,604,681 E177G probably damaging Het
Knl1 A G 2: 119,070,403 I862V probably benign Het
Lonp2 T A 8: 86,673,071 probably null Het
Map3k19 G T 1: 127,830,355 P363T probably damaging Het
Morn3 A G 5: 123,041,115 Y91H probably damaging Het
Myom2 A G 8: 15,108,478 D810G probably benign Het
Nans A G 4: 46,500,180 Y188C probably damaging Het
Ndufs1 A T 1: 63,147,389 D1E probably benign Het
Nelfb T C 2: 25,209,993 N204S probably damaging Het
Noxo1 T C 17: 24,698,542 S31P probably damaging Het
Olfr312 T A 11: 58,831,556 M134K probably damaging Het
Olfr914 T C 9: 38,606,663 L66S probably damaging Het
Pkd1l2 T G 8: 117,065,746 T436P possibly damaging Het
Pkhd1l1 A G 15: 44,581,790 D3686G probably damaging Het
Ppp2r5b A G 19: 6,230,944 L285S probably damaging Het
Pzp A T 6: 128,506,869 V522D probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rpe65 A G 3: 159,615,676 D375G probably benign Het
Sacs C T 14: 61,211,547 L3681F probably damaging Het
Sft2d1 C T 17: 8,320,653 T96I probably damaging Het
Slc12a7 A G 13: 73,793,940 N312D probably benign Het
Spaca6 A T 17: 17,831,247 K82* probably null Het
Stk32c A G 7: 139,188,279 probably benign Het
Tet2 T A 3: 133,487,885 N263Y probably damaging Het
Uxs1 T C 1: 43,780,073 N190S probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Olfr53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Olfr53 APN 7 140652476 missense probably benign 0.00
IGL01071:Olfr53 APN 7 140652914 missense possibly damaging 0.76
IGL02590:Olfr53 APN 7 140652392 unclassified probably null
IGL02694:Olfr53 APN 7 140652180 missense probably damaging 0.99
R0071:Olfr53 UTSW 7 140652257 missense probably benign 0.00
R0071:Olfr53 UTSW 7 140652257 missense probably benign 0.00
R0089:Olfr53 UTSW 7 140652311 missense probably damaging 0.99
R0586:Olfr53 UTSW 7 140652063 missense probably benign 0.35
R1209:Olfr53 UTSW 7 140652014 missense probably benign 0.03
R1491:Olfr53 UTSW 7 140652737 missense probably damaging 1.00
R1781:Olfr53 UTSW 7 140652506 missense probably damaging 0.99
R4060:Olfr53 UTSW 7 140652120 missense probably damaging 1.00
R4231:Olfr53 UTSW 7 140652740 missense probably damaging 1.00
R4236:Olfr53 UTSW 7 140652740 missense probably damaging 1.00
R4299:Olfr53 UTSW 7 140652243 missense probably benign 0.00
R4398:Olfr53 UTSW 7 140652828 missense possibly damaging 0.65
R4675:Olfr53 UTSW 7 140652161 missense probably damaging 1.00
R4937:Olfr53 UTSW 7 140652621 missense probably benign 0.00
R6124:Olfr53 UTSW 7 140652594 missense probably damaging 1.00
R7092:Olfr53 UTSW 7 140652237 missense probably benign 0.16
R7167:Olfr53 UTSW 7 140652553 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCGCTATGTGGCTATCTGC -3'
(R):5'- ACAGATGAGTAGTACACTGAGACC -3'

Sequencing Primer
(F):5'- CTACACTACAGCTCTAGGATGAG -3'
(R):5'- GTAGTACACTGAGACCACGATG -3'
Posted On2017-02-10