Incidental Mutation 'R5854:Dalrd3'
ID454827
Institutional Source Beutler Lab
Gene Symbol Dalrd3
Ensembl Gene ENSMUSG00000019039
Gene NameDALR anticodon binding domain containing 3
Synonyms6330580J24Rik
MMRRC Submission 043228-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5854 (G1)
Quality Score218
Status Not validated
Chromosome9
Chromosomal Location108569886-108572774 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 108570077 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019183] [ENSMUST00000068700] [ENSMUST00000074208] [ENSMUST00000081111] [ENSMUST00000193427] [ENSMUST00000194381] [ENSMUST00000194904] [ENSMUST00000195249]
Predicted Effect probably null
Transcript: ENSMUST00000019183
SMART Domains Protein: ENSMUSP00000019183
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 288 301 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
DALR_1 399 538 2.09e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068700
SMART Domains Protein: ENSMUSP00000070927
Gene: ENSMUSG00000066357

DomainStartEndE-ValueType
Blast:WD40 109 142 3e-6 BLAST
WD40 198 237 1.42e-4 SMART
WD40 247 284 7.28e-2 SMART
WD40 286 326 1.72e-3 SMART
Blast:WD40 336 375 3e-13 BLAST
WD40 479 519 2.96e1 SMART
low complexity region 537 552 N/A INTRINSIC
WD40 559 598 1.77e2 SMART
Blast:WD40 600 641 7e-20 BLAST
Blast:WD40 764 815 2e-22 BLAST
Blast:WD40 855 896 2e-11 BLAST
WD40 900 949 1.48e1 SMART
WD40 973 1015 5.52e-2 SMART
WD40 1035 1076 3.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074208
SMART Domains Protein: ENSMUSP00000073832
Gene: ENSMUSG00000070283

DomainStartEndE-ValueType
Pfam:DUF498 61 169 9.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081111
SMART Domains Protein: ENSMUSP00000079888
Gene: ENSMUSG00000062867

DomainStartEndE-ValueType
IMPDH 28 504 7.39e-260 SMART
CBS 117 168 9.4e-7 SMART
CBS 184 232 1.57e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191897
Predicted Effect probably benign
Transcript: ENSMUST00000192518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193242
Predicted Effect probably benign
Transcript: ENSMUST00000193427
SMART Domains Protein: ENSMUSP00000141748
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
DALR_1 68 171 1.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194104
Predicted Effect probably benign
Transcript: ENSMUST00000194381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194689
Predicted Effect probably benign
Transcript: ENSMUST00000194904
SMART Domains Protein: ENSMUSP00000142305
Gene: ENSMUSG00000062867

DomainStartEndE-ValueType
IMPDH 1 319 5e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196210
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The exact function of this gene is not known. It encodes a protein with a DALR anticodon binding domain similar to that of class Ia aminoacyl tRNA synthetases. This gene is located in a cluster of genes (with a complex sense-anti-sense genome architecture) on chromosome 3, and contains two micro RNA (miRNA) precursors (mir-425 and mir-191) in one of its introns. Preferential expression of this gene (the miRNAs and other genes in the cluster) in testis suggests a role of this gene in spermatogenesis (PMID:19906709). [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atg4c G A 4: 99,228,559 V313I probably benign Het
Ccdc18 A G 5: 108,206,728 E1111G possibly damaging Het
Chuk T C 19: 44,081,957 H573R probably benign Het
Cst13 A G 2: 148,828,174 N88S probably benign Het
Dnah8 T A 17: 30,794,763 M3826K possibly damaging Het
Dsp A G 13: 38,167,501 probably null Het
Fbxo41 A G 6: 85,475,094 L810P probably damaging Het
Fcrlb T C 1: 170,907,961 Y248C probably damaging Het
Gmcl1 A G 6: 86,714,259 silent Het
Gtf3c3 C A 1: 54,419,437 A442S probably benign Het
Hdac4 T C 1: 91,959,421 S799G probably damaging Het
Hnrnpa2b1 C G 6: 51,466,609 probably benign Het
Hnrnpab T C 11: 51,604,681 E177G probably damaging Het
Knl1 A G 2: 119,070,403 I862V probably benign Het
Lonp2 T A 8: 86,673,071 probably null Het
Map3k19 G T 1: 127,830,355 P363T probably damaging Het
Morn3 A G 5: 123,041,115 Y91H probably damaging Het
Myom2 A G 8: 15,108,478 D810G probably benign Het
Nans A G 4: 46,500,180 Y188C probably damaging Het
Ndufs1 A T 1: 63,147,389 D1E probably benign Het
Nelfb T C 2: 25,209,993 N204S probably damaging Het
Noxo1 T C 17: 24,698,542 S31P probably damaging Het
Olfr312 T A 11: 58,831,556 M134K probably damaging Het
Olfr53 A G 7: 140,652,578 M200V probably benign Het
Olfr914 T C 9: 38,606,663 L66S probably damaging Het
Pkd1l2 T G 8: 117,065,746 T436P possibly damaging Het
Pkhd1l1 A G 15: 44,581,790 D3686G probably damaging Het
Ppp2r5b A G 19: 6,230,944 L285S probably damaging Het
Pzp A T 6: 128,506,869 V522D probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rpe65 A G 3: 159,615,676 D375G probably benign Het
Sacs C T 14: 61,211,547 L3681F probably damaging Het
Sft2d1 C T 17: 8,320,653 T96I probably damaging Het
Slc12a7 A G 13: 73,793,940 N312D probably benign Het
Spaca6 A T 17: 17,831,247 K82* probably null Het
Stk32c A G 7: 139,188,279 probably benign Het
Tet2 T A 3: 133,487,885 N263Y probably damaging Het
Uxs1 T C 1: 43,780,073 N190S probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Dalrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02441:Dalrd3 APN 9 108571526 unclassified probably benign
IGL02699:Dalrd3 APN 9 108570889 splice site probably benign
IGL02701:Dalrd3 APN 9 108572284 missense possibly damaging 0.95
R0051:Dalrd3 UTSW 9 108572215 missense possibly damaging 0.89
R0051:Dalrd3 UTSW 9 108572215 missense possibly damaging 0.89
R2025:Dalrd3 UTSW 9 108571085 missense probably benign 0.08
R4425:Dalrd3 UTSW 9 108571601 unclassified probably benign
R4552:Dalrd3 UTSW 9 108572230 missense possibly damaging 0.67
R4660:Dalrd3 UTSW 9 108570369 missense probably benign
R4876:Dalrd3 UTSW 9 108571436 splice site probably benign
R5642:Dalrd3 UTSW 9 108572290 missense probably damaging 1.00
R6342:Dalrd3 UTSW 9 108571123 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCTCTACGGATAACTTACTTCCTG -3'
(R):5'- ACATGTTCGAAGACAGCGGG -3'

Sequencing Primer
(F):5'- TAGTCTTCCGGTCGCCATGG -3'
(R):5'- GCCGCTGTAGTTGGAGC -3'
Posted On2017-02-10