Incidental Mutation 'R5854:Olfr312'
ID454830
Institutional Source Beutler Lab
Gene Symbol Olfr312
Ensembl Gene ENSMUSG00000096806
Gene Nameolfactory receptor 312
SynonymsGA_x6K02T2NKPP-575829-574903, MOR222-4P
MMRRC Submission 043228-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R5854 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58829237-58834780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58831556 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 134 (M134K)
Ref Sequence ENSEMBL: ENSMUSP00000149697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078217] [ENSMUST00000216407]
Predicted Effect probably damaging
Transcript: ENSMUST00000078217
AA Change: M134K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077344
Gene: ENSMUSG00000096806
AA Change: M134K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.5e-53 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1.9e-8 PFAM
Pfam:7tm_1 39 288 4.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216407
AA Change: M134K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atg4c G A 4: 99,228,559 V313I probably benign Het
Ccdc18 A G 5: 108,206,728 E1111G possibly damaging Het
Chuk T C 19: 44,081,957 H573R probably benign Het
Cst13 A G 2: 148,828,174 N88S probably benign Het
Dalrd3 T C 9: 108,570,077 probably null Het
Dnah8 T A 17: 30,794,763 M3826K possibly damaging Het
Dsp A G 13: 38,167,501 probably null Het
Fbxo41 A G 6: 85,475,094 L810P probably damaging Het
Fcrlb T C 1: 170,907,961 Y248C probably damaging Het
Gmcl1 A G 6: 86,714,259 silent Het
Gtf3c3 C A 1: 54,419,437 A442S probably benign Het
Hdac4 T C 1: 91,959,421 S799G probably damaging Het
Hnrnpa2b1 C G 6: 51,466,609 probably benign Het
Hnrnpab T C 11: 51,604,681 E177G probably damaging Het
Knl1 A G 2: 119,070,403 I862V probably benign Het
Lonp2 T A 8: 86,673,071 probably null Het
Map3k19 G T 1: 127,830,355 P363T probably damaging Het
Morn3 A G 5: 123,041,115 Y91H probably damaging Het
Myom2 A G 8: 15,108,478 D810G probably benign Het
Nans A G 4: 46,500,180 Y188C probably damaging Het
Ndufs1 A T 1: 63,147,389 D1E probably benign Het
Nelfb T C 2: 25,209,993 N204S probably damaging Het
Noxo1 T C 17: 24,698,542 S31P probably damaging Het
Olfr53 A G 7: 140,652,578 M200V probably benign Het
Olfr914 T C 9: 38,606,663 L66S probably damaging Het
Pkd1l2 T G 8: 117,065,746 T436P possibly damaging Het
Pkhd1l1 A G 15: 44,581,790 D3686G probably damaging Het
Ppp2r5b A G 19: 6,230,944 L285S probably damaging Het
Pzp A T 6: 128,506,869 V522D probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rpe65 A G 3: 159,615,676 D375G probably benign Het
Sacs C T 14: 61,211,547 L3681F probably damaging Het
Sft2d1 C T 17: 8,320,653 T96I probably damaging Het
Slc12a7 A G 13: 73,793,940 N312D probably benign Het
Spaca6 A T 17: 17,831,247 K82* probably null Het
Stk32c A G 7: 139,188,279 probably benign Het
Tet2 T A 3: 133,487,885 N263Y probably damaging Het
Uxs1 T C 1: 43,780,073 N190S probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Olfr312
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01897:Olfr312 APN 11 58831639 missense probably damaging 1.00
R0442:Olfr312 UTSW 11 58831431 nonsense probably null
R0540:Olfr312 UTSW 11 58831972 missense probably damaging 0.96
R0607:Olfr312 UTSW 11 58831972 missense probably damaging 0.96
R2366:Olfr312 UTSW 11 58831213 missense probably benign 0.00
R3437:Olfr312 UTSW 11 58831324 missense probably damaging 1.00
R4135:Olfr312 UTSW 11 58831994 missense probably damaging 1.00
R4391:Olfr312 UTSW 11 58832015 missense possibly damaging 0.81
R5557:Olfr312 UTSW 11 58831987 missense probably benign 0.01
R5564:Olfr312 UTSW 11 58831213 nonsense probably null
R6791:Olfr312 UTSW 11 58832077 missense probably benign
R7336:Olfr312 UTSW 11 58831924 missense probably damaging 0.99
R7344:Olfr312 UTSW 11 58831482 missense probably damaging 1.00
R7397:Olfr312 UTSW 11 58831289 missense probably benign 0.05
X0067:Olfr312 UTSW 11 58831988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGCAGTGGTGATATCCCTC -3'
(R):5'- AGGACGAATGAGCTCATGAC -3'

Sequencing Primer
(F):5'- AGTGGTGATATCCCTCACAGG -3'
(R):5'- ACCTCCTCAGTGAGATGGTAGTCAG -3'
Posted On2017-02-10