Incidental Mutation 'R5857:Dlgap1'
ID454983
Institutional Source Beutler Lab
Gene Symbol Dlgap1
Ensembl Gene ENSMUSG00000003279
Gene NameDLG associated protein 1
SynonymsGKAP/SAPAP, 4933422O14Rik, SAPAP1, Gkap, Sapap1, D17Bwg0511e, DAP-1 beta
MMRRC Submission 044069-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5857 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location69969073-70821413 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 70815393 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060072] [ENSMUST00000097288] [ENSMUST00000133717] [ENSMUST00000133983] [ENSMUST00000135938] [ENSMUST00000140728] [ENSMUST00000146730] [ENSMUST00000148486] [ENSMUST00000155016]
Predicted Effect probably benign
Transcript: ENSMUST00000060072
SMART Domains Protein: ENSMUSP00000052858
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000097288
AA Change: N631S
SMART Domains Protein: ENSMUSP00000094890
Gene: ENSMUSG00000003279
AA Change: N631S

DomainStartEndE-ValueType
low complexity region 208 228 N/A INTRINSIC
low complexity region 244 261 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
Pfam:GKAP 345 625 9.4e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133717
SMART Domains Protein: ENSMUSP00000122370
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 218 238 N/A INTRINSIC
low complexity region 312 326 N/A INTRINSIC
Pfam:GKAP 327 666 1.3e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133983
SMART Domains Protein: ENSMUSP00000116716
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135938
SMART Domains Protein: ENSMUSP00000118497
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 610 624 N/A INTRINSIC
Pfam:GKAP 625 964 9.3e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140728
SMART Domains Protein: ENSMUSP00000117358
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 216 236 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
Pfam:GKAP 353 692 1.4e-139 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000146730
AA Change: N939S
SMART Domains Protein: ENSMUSP00000116072
Gene: ENSMUSG00000003279
AA Change: N939S

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 653 933 9.5e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148486
SMART Domains Protein: ENSMUSP00000122337
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 215 239 N/A INTRINSIC
low complexity region 242 259 N/A INTRINSIC
low complexity region 328 342 N/A INTRINSIC
Pfam:GKAP 343 682 1.3e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155016
SMART Domains Protein: ENSMUSP00000122896
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 660 992 2e-153 PFAM
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 95% (55/58)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,449,525 I266V probably benign Het
Anks6 C T 4: 47,039,736 A492T possibly damaging Het
Ano1 A T 7: 144,637,103 C415S probably benign Het
Anxa3 T A 5: 96,828,792 probably null Het
Apob T C 12: 8,015,397 V4089A probably benign Het
Arhgap23 C T 11: 97,451,579 A229V possibly damaging Het
Atad5 T C 11: 80,131,329 F1447L probably benign Het
Btbd8 T A 5: 107,461,532 D212E probably damaging Het
Ccdc38 G T 10: 93,562,833 A58S possibly damaging Het
Cep112 T C 11: 108,531,471 probably benign Het
Col4a2 G A 8: 11,425,442 G622D probably damaging Het
Crhbp T A 13: 95,442,232 Q134L probably benign Het
Ctnnbl1 T C 2: 157,789,098 S145P probably damaging Het
Cyp4f16 T A 17: 32,537,024 L9Q probably damaging Het
Dchs2 T G 3: 83,270,313 I891S possibly damaging Het
Disp3 A T 4: 148,249,183 V1066D probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Efl1 T A 7: 82,763,189 C929S probably benign Het
Fam129b T A 2: 32,909,908 N82K probably benign Het
Gatb T C 3: 85,575,932 F82S probably damaging Het
Gk5 C A 9: 96,119,455 S2* probably null Het
Gpr135 G A 12: 72,070,840 A51V probably benign Het
Hoxa9 T A 6: 52,224,297 N255Y probably damaging Het
Igkv8-18 T C 6: 70,355,920 V15A probably benign Het
Ism2 T C 12: 87,280,061 D368G probably damaging Het
Krtap6-2 A T 16: 89,419,642 S146T unknown Het
Lama1 T A 17: 67,807,843 L2329H probably damaging Het
Llgl2 T A 11: 115,850,281 I507N probably damaging Het
Lmna GCTGCCCACAC GC 3: 88,482,531 probably benign Het
Lrfn3 A T 7: 30,359,438 I454N possibly damaging Het
Mdn1 C A 4: 32,670,646 T437K probably benign Het
Nat8f3 T C 6: 85,761,753 Y9C probably damaging Het
Nlrp4d C A 7: 10,382,377 G156V noncoding transcript Het
Npnt A T 3: 132,908,349 C167S probably damaging Het
Nr3c2 A G 8: 76,908,867 N199S possibly damaging Het
Olfr248 T G 1: 174,391,108 I13R possibly damaging Het
Olfr870 C T 9: 20,171,239 D111N probably damaging Het
Olfr884 T G 9: 38,047,753 V177G probably benign Het
Pabpc1l T A 2: 164,044,255 probably null Het
Pi4ka A G 16: 17,358,984 I366T probably benign Het
Prl7a1 A T 13: 27,640,701 D50E probably damaging Het
Rad52 T G 6: 119,911,007 probably null Het
Rbm19 T A 5: 120,132,942 L610Q probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scube1 G T 15: 83,607,260 probably benign Het
Sptbn4 G T 7: 27,418,713 R314S possibly damaging Het
Togaram1 T A 12: 64,995,557 I1130K possibly damaging Het
Tsc2 T C 17: 24,600,007 E1352G probably damaging Het
Ube2d2a A G 18: 35,805,543 T142A probably benign Het
Vps18 T C 2: 119,297,533 Y946H probably damaging Het
Other mutations in Dlgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dlgap1 APN 17 70516085 missense probably benign 0.02
IGL01413:Dlgap1 APN 17 70516074 missense probably benign 0.00
IGL01531:Dlgap1 APN 17 70516379 missense probably damaging 1.00
IGL02226:Dlgap1 APN 17 70516034 missense probably damaging 1.00
R0453:Dlgap1 UTSW 17 70761346 missense probably benign 0.03
R0482:Dlgap1 UTSW 17 70516190 missense probably benign 0.11
R0520:Dlgap1 UTSW 17 70516994 nonsense probably null
R1951:Dlgap1 UTSW 17 70761311 missense probably damaging 0.96
R2072:Dlgap1 UTSW 17 70662770 missense probably damaging 0.99
R2076:Dlgap1 UTSW 17 70786831 nonsense probably null
R3438:Dlgap1 UTSW 17 70516361 missense probably damaging 0.97
R3743:Dlgap1 UTSW 17 70718226 critical splice donor site probably null
R3881:Dlgap1 UTSW 17 70786815 missense probably damaging 1.00
R3981:Dlgap1 UTSW 17 70516785 missense probably damaging 1.00
R4043:Dlgap1 UTSW 17 70761080 missense probably damaging 1.00
R4272:Dlgap1 UTSW 17 70766043 missense probably benign
R4273:Dlgap1 UTSW 17 70766043 missense probably benign
R4557:Dlgap1 UTSW 17 70516689 missense probably benign 0.01
R4652:Dlgap1 UTSW 17 70761095 missense probably damaging 1.00
R4771:Dlgap1 UTSW 17 70593380 nonsense probably null
R5000:Dlgap1 UTSW 17 70766058 missense probably damaging 1.00
R5004:Dlgap1 UTSW 17 70718227 critical splice donor site probably null
R5291:Dlgap1 UTSW 17 70718210 missense probably benign 0.03
R5304:Dlgap1 UTSW 17 70815207 missense probably damaging 1.00
R5473:Dlgap1 UTSW 17 70517030 intron probably benign
R5522:Dlgap1 UTSW 17 70516998 critical splice donor site probably null
R5586:Dlgap1 UTSW 17 70818161 missense probably damaging 1.00
R5742:Dlgap1 UTSW 17 70718199 missense probably benign
R5802:Dlgap1 UTSW 17 70766091 critical splice donor site probably null
R5850:Dlgap1 UTSW 17 70787092 missense probably damaging 1.00
R5883:Dlgap1 UTSW 17 70517013 intron probably benign
R6045:Dlgap1 UTSW 17 70818098 missense probably damaging 1.00
R6336:Dlgap1 UTSW 17 70815289 missense probably damaging 1.00
R6448:Dlgap1 UTSW 17 70593330 missense possibly damaging 0.59
R6682:Dlgap1 UTSW 17 70787123 missense probably damaging 1.00
R6795:Dlgap1 UTSW 17 70818074 missense possibly damaging 0.48
R7147:Dlgap1 UTSW 17 70662758 missense probably benign 0.00
R7187:Dlgap1 UTSW 17 70516098 missense possibly damaging 0.93
R7382:Dlgap1 UTSW 17 70787174 missense probably damaging 1.00
T0975:Dlgap1 UTSW 17 70516955 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTAAAGCGCCAATGTCTTTCTC -3'
(R):5'- TCCCGTTTCCCAATTCACAAAG -3'

Sequencing Primer
(F):5'- TTTTGCACAGAATCCCAATGC -3'
(R):5'- CCCAATTCACAAAGACAGGTTTTTC -3'
Posted On2017-02-10