Incidental Mutation 'R5858:Muc15'
ID454991
Institutional Source Beutler Lab
Gene Symbol Muc15
Ensembl Gene ENSMUSG00000050808
Gene Namemucin 15
Synonyms
MMRRC Submission 044070-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5858 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location110721340-110739527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110731798 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 193 (D193G)
Ref Sequence ENSEMBL: ENSMUSP00000106646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090332] [ENSMUST00000099623] [ENSMUST00000111016] [ENSMUST00000111017] [ENSMUST00000140777]
Predicted Effect probably damaging
Transcript: ENSMUST00000090332
AA Change: D193G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087805
Gene: ENSMUSG00000050808
AA Change: D193G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Mucin15 21 331 2.3e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099623
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111016
AA Change: D193G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106645
Gene: ENSMUSG00000050808
AA Change: D193G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 93 108 N/A INTRINSIC
low complexity region 163 181 N/A INTRINSIC
transmembrane domain 235 257 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111017
AA Change: D193G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106646
Gene: ENSMUSG00000050808
AA Change: D193G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 93 108 N/A INTRINSIC
low complexity region 163 181 N/A INTRINSIC
transmembrane domain 235 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140777
SMART Domains Protein: ENSMUSP00000122387
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 40 141 5.7e-24 PFAM
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,853,605 Q102L probably benign Het
Ak9 G A 10: 41,423,027 V1575I unknown Het
Alg14 G A 3: 121,320,088 probably benign Het
Arl5a T C 2: 52,412,106 I99V probably benign Het
Cacul1 T C 19: 60,529,044 probably benign Het
Cc2d2a C T 5: 43,715,775 R934C probably damaging Het
Ccr2 A G 9: 124,106,427 E248G probably benign Het
Cds2 G T 2: 132,302,113 V287L probably benign Het
Cflar T C 1: 58,753,851 S459P probably benign Het
Clcc1 A G 3: 108,661,428 D21G probably damaging Het
Col8a2 C T 4: 126,311,300 probably benign Het
Cops7a A T 6: 124,960,171 S186T possibly damaging Het
Dagla C T 19: 10,254,968 probably benign Het
Dapp1 T C 3: 137,961,531 Y49C possibly damaging Het
Dnase1 T C 16: 4,039,649 probably benign Het
Dock9 A G 14: 121,628,792 V633A probably benign Het
E4f1 A G 17: 24,445,328 F461L probably damaging Het
Epg5 T A 18: 77,948,299 C70* probably null Het
Ephb2 T C 4: 136,672,445 H589R probably benign Het
Fam184b A T 5: 45,639,119 C41S probably damaging Het
Hace1 A G 10: 45,711,525 T907A possibly damaging Het
Il31 T A 5: 123,480,574 T129S probably benign Het
Il6 A T 5: 30,013,474 T23S possibly damaging Het
Kif12 T C 4: 63,166,410 E557G probably benign Het
Krt24 A T 11: 99,284,765 L148H probably damaging Het
Mapk8ip1 A G 2: 92,384,972 F635S probably damaging Het
Mcc A T 18: 44,510,141 V313E probably damaging Het
Nbea A G 3: 55,953,034 probably null Het
Olfr1145 A T 2: 87,810,641 I274F probably benign Het
Olfr1442 A G 19: 12,674,379 Y58C probably damaging Het
Olfr165 A G 16: 19,407,225 S265P possibly damaging Het
Olfr705 T A 7: 106,873,768 Y159F probably benign Het
P4ha1 A T 10: 59,339,378 L53F probably damaging Het
Pcdha7 A G 18: 36,976,226 D768G probably damaging Het
Pdzd2 T A 15: 12,442,589 D208V probably damaging Het
Ptk2 A T 15: 73,321,095 I159K probably benign Het
Rfx6 A G 10: 51,725,868 N761S probably benign Het
Rpp25l A T 4: 41,712,678 D32E probably benign Het
Rxrg A T 1: 167,627,356 K169N probably damaging Het
Ryr2 T C 13: 11,560,574 D4846G probably damaging Het
Sec23a A G 12: 58,973,035 F553S probably damaging Het
Spen T C 4: 141,473,871 I2482V probably benign Het
Ston1 A G 17: 88,635,631 D155G possibly damaging Het
Tha1 A G 11: 117,873,384 F6L unknown Het
Trank1 T A 9: 111,392,536 D2780E probably benign Het
Ubqln5 T C 7: 104,128,811 T269A probably benign Het
Vars C T 17: 35,005,475 R324C probably benign Het
Zfp287 T A 11: 62,714,007 Q691H probably damaging Het
Other mutations in Muc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01978:Muc15 APN 2 110731596 missense probably benign 0.00
IGL02547:Muc15 APN 2 110731305 missense probably damaging 0.97
IGL02751:Muc15 APN 2 110731773 missense probably benign 0.14
IGL03100:Muc15 APN 2 110731594 missense probably damaging 0.99
IGL03188:Muc15 APN 2 110731699 missense probably benign 0.14
R0684:Muc15 UTSW 2 110733815 missense possibly damaging 0.95
R1472:Muc15 UTSW 2 110731560 missense probably damaging 1.00
R1582:Muc15 UTSW 2 110737472 missense probably benign 0.16
R1661:Muc15 UTSW 2 110733898 nonsense probably null
R1665:Muc15 UTSW 2 110733898 nonsense probably null
R1725:Muc15 UTSW 2 110731246 missense probably damaging 0.96
R1815:Muc15 UTSW 2 110731258 missense probably damaging 1.00
R1892:Muc15 UTSW 2 110737352 nonsense probably null
R2022:Muc15 UTSW 2 110731476 missense probably benign 0.00
R4546:Muc15 UTSW 2 110737499 missense probably damaging 0.97
R4953:Muc15 UTSW 2 110731272 missense probably damaging 0.99
R4984:Muc15 UTSW 2 110731573 missense probably damaging 1.00
R6046:Muc15 UTSW 2 110731441 nonsense probably null
R6695:Muc15 UTSW 2 110731271 missense probably damaging 1.00
R7468:Muc15 UTSW 2 110731517 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAATCCTTTACAGGTCTCCGAAC -3'
(R):5'- CCCCAGAATGCCACTCTTTG -3'

Sequencing Primer
(F):5'- AGGTCTCCGAACATTCCAATTC -3'
(R):5'- GAGATTCCTCTCTAGCCTT -3'
Posted On2017-02-10