Incidental Mutation 'R5859:Chrdl2'
ID455064
Institutional Source Beutler Lab
Gene Symbol Chrdl2
Ensembl Gene ENSMUSG00000030732
Gene Namechordin-like 2
Synonyms1810022C01Rik, Chl2
MMRRC Submission 044071-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R5859 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100006172-100034728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100020907 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 79 (Y79C)
Ref Sequence ENSEMBL: ENSMUSP00000102699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032977] [ENSMUST00000107084]
Predicted Effect probably damaging
Transcript: ENSMUST00000032977
AA Change: Y72C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032977
Gene: ENSMUSG00000030732
AA Change: Y72C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 33 95 1.13e-3 SMART
VWC 111 174 1.58e-1 SMART
low complexity region 207 219 N/A INTRINSIC
VWC 248 310 3.09e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107084
AA Change: Y79C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102699
Gene: ENSMUSG00000030732
AA Change: Y79C

DomainStartEndE-ValueType
VWC 40 102 1.13e-3 SMART
VWC 118 181 1.58e-1 SMART
low complexity region 214 226 N/A INTRINSIC
VWC 255 317 3.09e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144808
SMART Domains Protein: ENSMUSP00000120760
Gene: ENSMUSG00000030732

DomainStartEndE-ValueType
Blast:VWC 2 34 2e-15 BLAST
low complexity region 67 79 N/A INTRINSIC
low complexity region 96 114 N/A INTRINSIC
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chordin family of proteins. Chordin family members are secreted proteins that share a cysteine-rich pro-collagen repeat domain and associate with members of the transforming growth factor beta superfamily. In vitro assays demonstrate a direct interaction between the encoded protein and human activin A. This gene is expressed in many tissues including osteoblasts, where it is differentially expressed during differentiation. In addition, its expression is upregulated in human osteoarthritic joint cartilage, suggesting a role in adult cartilage regeneration. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,813,461 V150E probably benign Het
Alg11 A G 8: 22,065,841 K373E probably benign Het
Arl14ep C T 2: 106,969,053 probably benign Het
Ascc2 G A 11: 4,658,284 G227R probably benign Het
Ash1l C T 3: 89,068,993 P2627S probably damaging Het
Btla T G 16: 45,239,039 probably null Het
Btnl10 C T 11: 58,922,312 P256S probably benign Het
Cep162 C T 9: 87,204,092 A1060T probably damaging Het
Cfap54 T A 10: 93,016,524 K907* probably null Het
Chpf A T 1: 75,475,428 F461I probably damaging Het
Copb2 G A 9: 98,568,108 C40Y probably benign Het
Cyfip1 T C 7: 55,925,181 L1060P probably damaging Het
Drg1 G A 11: 3,259,273 probably benign Het
Erich3 A G 3: 154,762,497 D862G possibly damaging Het
Flii G T 11: 60,716,311 Y946* probably null Het
Glt8d2 T C 10: 82,672,081 M1V probably null Het
Gm21136 T A 7: 38,867,741 noncoding transcript Het
Gramd1c T C 16: 43,992,091 T393A possibly damaging Het
Gucy2d T A 7: 98,451,883 I471N probably benign Het
Hps3 G A 3: 20,008,870 T711M probably benign Het
Hs3st4 A T 7: 123,983,608 D143V probably benign Het
Kif17 T A 4: 138,291,433 M461K possibly damaging Het
Klhdc7a T A 4: 139,967,574 S21C probably damaging Het
Klk15 G A 7: 43,938,376 R76H probably benign Het
Lnpk G A 2: 74,569,028 T57I possibly damaging Het
Ltbp2 A G 12: 84,794,063 V999A possibly damaging Het
Ltbr T C 6: 125,312,808 H141R probably damaging Het
Lvrn T C 18: 46,893,749 F805L probably damaging Het
Ms4a13 A T 19: 11,183,916 C86* probably null Het
Ncbp1 A G 4: 46,163,026 N480S probably benign Het
Nelfcd T G 2: 174,427,063 *592G probably null Het
Neurog2 T C 3: 127,634,015 V96A probably benign Het
Nod1 A T 6: 54,930,177 W902R probably benign Het
Olfr103 T C 17: 37,336,369 I288V possibly damaging Het
Olfr213 T C 6: 116,540,900 L149P probably damaging Het
Olfr543 T C 7: 102,477,750 Y40C possibly damaging Het
Olfr726 T A 14: 50,084,027 Y218F probably damaging Het
Pcdha11 A T 18: 37,007,283 H655L probably damaging Het
Plpp7 A G 2: 32,095,984 E58G probably benign Het
Psph A T 5: 129,790,621 probably benign Het
Rab11fip1 A C 8: 27,154,720 S346A probably damaging Het
Rreb1 C A 13: 37,947,408 P1513T probably benign Het
Rreb1 C T 13: 37,947,409 P1513L probably benign Het
Rsf1 C T 7: 97,685,559 R1300C probably damaging Het
Scap A G 9: 110,374,047 N263S probably benign Het
Sec24d A T 3: 123,279,312 probably benign Het
Slain2 T C 5: 72,948,545 probably benign Het
Slc6a18 G T 13: 73,668,159 T367N probably benign Het
Slk T A 19: 47,609,042 D96E probably benign Het
Spag5 G A 11: 78,313,534 V514I probably benign Het
St8sia2 T C 7: 73,966,906 D107G probably damaging Het
Tgfbr3 T A 5: 107,140,515 I427F probably benign Het
Tlr2 T G 3: 83,836,503 T758P possibly damaging Het
Tmem270 A G 5: 134,902,884 V68A probably benign Het
Vmn2r106 T A 17: 20,285,321 H37L possibly damaging Het
Vmn2r27 T G 6: 124,200,688 R452S probably damaging Het
Wdr5 A G 2: 27,533,350 Y252C probably damaging Het
Zswim9 C T 7: 13,261,445 V262M probably damaging Het
Other mutations in Chrdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Chrdl2 APN 7 100034641 missense probably damaging 0.96
IGL00965:Chrdl2 APN 7 100006653 splice site probably null
IGL01320:Chrdl2 APN 7 100017041 missense probably damaging 1.00
IGL01322:Chrdl2 APN 7 100017041 missense probably damaging 1.00
IGL01977:Chrdl2 APN 7 100022056 missense probably benign 0.33
IGL02170:Chrdl2 APN 7 100034614 missense possibly damaging 0.92
IGL02478:Chrdl2 APN 7 100020983 critical splice donor site probably null
IGL02745:Chrdl2 APN 7 100020963 missense probably damaging 1.00
IGL03117:Chrdl2 APN 7 100027580 missense possibly damaging 0.83
IGL03377:Chrdl2 APN 7 100022052 missense probably benign 0.03
Measley UTSW 7 100010121 critical splice donor site probably null
R1453:Chrdl2 UTSW 7 100016990 missense possibly damaging 0.64
R1900:Chrdl2 UTSW 7 100033664 missense possibly damaging 0.75
R2092:Chrdl2 UTSW 7 100020977 nonsense probably null
R3421:Chrdl2 UTSW 7 100023868 missense probably damaging 1.00
R3949:Chrdl2 UTSW 7 100029205 missense possibly damaging 0.89
R4305:Chrdl2 UTSW 7 100022022 missense probably damaging 1.00
R4306:Chrdl2 UTSW 7 100022022 missense probably damaging 1.00
R4776:Chrdl2 UTSW 7 100006541 unclassified probably benign
R5208:Chrdl2 UTSW 7 100023922 missense probably damaging 0.96
R5327:Chrdl2 UTSW 7 100028741 missense probably damaging 1.00
R5928:Chrdl2 UTSW 7 100009993 start gained probably benign
R6706:Chrdl2 UTSW 7 100010121 critical splice donor site probably null
R7027:Chrdl2 UTSW 7 100022033 missense probably damaging 1.00
R7039:Chrdl2 UTSW 7 100028672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTAAATGAGATCCGCTGAG -3'
(R):5'- TATCTAACAGACAGGGCTGCTCC -3'

Sequencing Primer
(F):5'- ATGAGATCCGCTGAGTGGGC -3'
(R):5'- AGACAGGGCTGCTCCTCTTC -3'
Posted On2017-02-10