Incidental Mutation 'R5859:Adam5'
ID455067
Institutional Source Beutler Lab
Gene Symbol Adam5
Ensembl Gene ENSMUSG00000031554
Gene Namea disintegrin and metallopeptidase domain 5
SynonymstMDCII
MMRRC Submission 044071-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.025) question?
Stock #R5859 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location24727093-24824369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24813461 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 150 (V150E)
Ref Sequence ENSEMBL: ENSMUSP00000147290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050300] [ENSMUST00000118419] [ENSMUST00000209935]
Predicted Effect probably benign
Transcript: ENSMUST00000050300
AA Change: V150E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052661
Gene: ENSMUSG00000031554
AA Change: V150E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 1.6e-19 PFAM
Pfam:Reprolysin 185 378 7.7e-59 PFAM
DISIN 397 474 9.1e-42 SMART
ACR 475 618 6.9e-58 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118419
AA Change: V150E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112422
Gene: ENSMUSG00000031554
AA Change: V150E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 4.7e-30 PFAM
Pfam:Reprolysin 185 378 7.9e-56 PFAM
DISIN 397 474 1.78e-39 SMART
ACR 475 618 2.06e-55 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130939
Predicted Effect unknown
Transcript: ENSMUST00000132180
AA Change: V67E
SMART Domains Protein: ENSMUSP00000121272
Gene: ENSMUSG00000031554
AA Change: V67E

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 1 60 6.7e-14 PFAM
Pfam:Reprolysin 103 296 2.5e-61 PFAM
DISIN 315 392 1.78e-39 SMART
ACR 393 536 2.06e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209935
AA Change: V150E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 A G 8: 22,065,841 K373E probably benign Het
Arl14ep C T 2: 106,969,053 probably benign Het
Ascc2 G A 11: 4,658,284 G227R probably benign Het
Ash1l C T 3: 89,068,993 P2627S probably damaging Het
Btla T G 16: 45,239,039 probably null Het
Btnl10 C T 11: 58,922,312 P256S probably benign Het
Cep162 C T 9: 87,204,092 A1060T probably damaging Het
Cfap54 T A 10: 93,016,524 K907* probably null Het
Chpf A T 1: 75,475,428 F461I probably damaging Het
Chrdl2 A G 7: 100,020,907 Y79C probably damaging Het
Copb2 G A 9: 98,568,108 C40Y probably benign Het
Cyfip1 T C 7: 55,925,181 L1060P probably damaging Het
Drg1 G A 11: 3,259,273 probably benign Het
Erich3 A G 3: 154,762,497 D862G possibly damaging Het
Flii G T 11: 60,716,311 Y946* probably null Het
Glt8d2 T C 10: 82,672,081 M1V probably null Het
Gm21136 T A 7: 38,867,741 noncoding transcript Het
Gramd1c T C 16: 43,992,091 T393A possibly damaging Het
Gucy2d T A 7: 98,451,883 I471N probably benign Het
Hps3 G A 3: 20,008,870 T711M probably benign Het
Hs3st4 A T 7: 123,983,608 D143V probably benign Het
Kif17 T A 4: 138,291,433 M461K possibly damaging Het
Klhdc7a T A 4: 139,967,574 S21C probably damaging Het
Klk15 G A 7: 43,938,376 R76H probably benign Het
Lnpk G A 2: 74,569,028 T57I possibly damaging Het
Ltbp2 A G 12: 84,794,063 V999A possibly damaging Het
Ltbr T C 6: 125,312,808 H141R probably damaging Het
Lvrn T C 18: 46,893,749 F805L probably damaging Het
Ms4a13 A T 19: 11,183,916 C86* probably null Het
Ncbp1 A G 4: 46,163,026 N480S probably benign Het
Nelfcd T G 2: 174,427,063 *592G probably null Het
Neurog2 T C 3: 127,634,015 V96A probably benign Het
Nod1 A T 6: 54,930,177 W902R probably benign Het
Olfr103 T C 17: 37,336,369 I288V possibly damaging Het
Olfr213 T C 6: 116,540,900 L149P probably damaging Het
Olfr543 T C 7: 102,477,750 Y40C possibly damaging Het
Olfr726 T A 14: 50,084,027 Y218F probably damaging Het
Pcdha11 A T 18: 37,007,283 H655L probably damaging Het
Plpp7 A G 2: 32,095,984 E58G probably benign Het
Psph A T 5: 129,790,621 probably benign Het
Rab11fip1 A C 8: 27,154,720 S346A probably damaging Het
Rreb1 C A 13: 37,947,408 P1513T probably benign Het
Rreb1 C T 13: 37,947,409 P1513L probably benign Het
Rsf1 C T 7: 97,685,559 R1300C probably damaging Het
Scap A G 9: 110,374,047 N263S probably benign Het
Sec24d A T 3: 123,279,312 probably benign Het
Slain2 T C 5: 72,948,545 probably benign Het
Slc6a18 G T 13: 73,668,159 T367N probably benign Het
Slk T A 19: 47,609,042 D96E probably benign Het
Spag5 G A 11: 78,313,534 V514I probably benign Het
St8sia2 T C 7: 73,966,906 D107G probably damaging Het
Tgfbr3 T A 5: 107,140,515 I427F probably benign Het
Tlr2 T G 3: 83,836,503 T758P possibly damaging Het
Tmem270 A G 5: 134,902,884 V68A probably benign Het
Vmn2r106 T A 17: 20,285,321 H37L possibly damaging Het
Vmn2r27 T G 6: 124,200,688 R452S probably damaging Het
Wdr5 A G 2: 27,533,350 Y252C probably damaging Het
Zswim9 C T 7: 13,261,445 V262M probably damaging Het
Other mutations in Adam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Adam5 APN 8 24818742 missense probably benign 0.18
IGL01285:Adam5 APN 8 24781594 missense probably benign 0.02
IGL01310:Adam5 APN 8 24742134 intron probably benign
IGL01510:Adam5 APN 8 24804465 missense probably damaging 1.00
IGL01570:Adam5 APN 8 24810823 missense probably damaging 1.00
IGL02017:Adam5 APN 8 24781759 missense probably benign 0.38
IGL02191:Adam5 APN 8 24812423 nonsense probably null
IGL02397:Adam5 APN 8 24744133 intron probably benign
IGL02488:Adam5 APN 8 24792006 missense probably damaging 0.98
IGL02490:Adam5 APN 8 24781704 nonsense probably null
IGL02499:Adam5 APN 8 24781565 critical splice donor site probably null
IGL02539:Adam5 APN 8 24786213 nonsense probably null
IGL02590:Adam5 APN 8 24744135 intron probably benign
IGL02677:Adam5 APN 8 24812379 splice site probably benign
IGL02679:Adam5 APN 8 24806526 missense probably damaging 1.00
IGL02982:Adam5 APN 8 24804431 missense probably benign 0.02
IGL03146:Adam5 APN 8 24804503 missense probably damaging 0.98
IGL03162:Adam5 APN 8 24781604 missense probably benign 0.30
IGL03284:Adam5 APN 8 24786338 splice site probably benign
R0081:Adam5 UTSW 8 24781687 missense probably damaging 1.00
R0377:Adam5 UTSW 8 24747541 missense probably benign 0.08
R0398:Adam5 UTSW 8 24813432 missense probably benign 0.17
R0771:Adam5 UTSW 8 24786299 missense probably benign 0.04
R0925:Adam5 UTSW 8 24812425 missense probably benign 0.09
R1547:Adam5 UTSW 8 24810713 missense probably benign 0.10
R1985:Adam5 UTSW 8 24746739 missense probably benign 0.01
R2115:Adam5 UTSW 8 24744145 intron probably benign
R2125:Adam5 UTSW 8 24815118 missense probably damaging 1.00
R2144:Adam5 UTSW 8 24815480 missense probably benign 0.14
R3151:Adam5 UTSW 8 24781631 missense probably damaging 0.99
R3612:Adam5 UTSW 8 24818089 splice site probably benign
R3844:Adam5 UTSW 8 24813410 missense probably benign 0.12
R3873:Adam5 UTSW 8 24815109 missense probably benign 0.02
R4514:Adam5 UTSW 8 24818136 missense probably damaging 1.00
R4843:Adam5 UTSW 8 24813536 missense probably damaging 1.00
R4866:Adam5 UTSW 8 24742156 splice site probably null
R4866:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4900:Adam5 UTSW 8 24742156 splice site probably null
R4900:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4903:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R4936:Adam5 UTSW 8 24786271 missense probably damaging 1.00
R4964:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R5259:Adam5 UTSW 8 24810834 missense possibly damaging 0.90
R5293:Adam5 UTSW 8 24810706 missense possibly damaging 0.46
R5724:Adam5 UTSW 8 24804495 nonsense probably null
R6004:Adam5 UTSW 8 24781669 missense probably benign 0.04
R6175:Adam5 UTSW 8 24786151 missense probably benign 0.00
R6539:Adam5 UTSW 8 24782600 missense possibly damaging 0.85
R6994:Adam5 UTSW 8 24786246 nonsense probably null
R6996:Adam5 UTSW 8 24806501 missense probably damaging 1.00
R7009:Adam5 UTSW 8 24806438 missense probably benign 0.00
R7115:Adam5 UTSW 8 24781696 missense possibly damaging 0.69
R7127:Adam5 UTSW 8 24810781 missense probably damaging 1.00
X0019:Adam5 UTSW 8 24812443 missense probably benign 0.00
X0022:Adam5 UTSW 8 24813563 critical splice acceptor site probably null
X0027:Adam5 UTSW 8 24818772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACAAAGTAAAACCATGCCGG -3'
(R):5'- GAAAACTCTGGCCAACCTTTGTC -3'

Sequencing Primer
(F):5'- GCCTTTAACATCAGCACTTGGGAG -3'
(R):5'- AAACTCTGGCCAACCTTTGTCTTTAG -3'
Posted On2017-02-10