Incidental Mutation 'R5859:Btnl10'
ID455078
Institutional Source Beutler Lab
Gene Symbol Btnl10
Ensembl Gene ENSMUSG00000020490
Gene Namebutyrophilin-like 10
SynonymsButr1, BUTR-1
MMRRC Submission 044071-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R5859 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58917908-58927158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58922312 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 256 (P256S)
Ref Sequence ENSEMBL: ENSMUSP00000063279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020792] [ENSMUST00000069941] [ENSMUST00000108818] [ENSMUST00000142499]
Predicted Effect probably benign
Transcript: ENSMUST00000020792
SMART Domains Protein: ENSMUSP00000020792
Gene: ENSMUSG00000020490

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 150 233 3.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069941
AA Change: P256S

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000063279
Gene: ENSMUSG00000020490
AA Change: P256S

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 150 233 5.5e-7 PFAM
PRY 300 352 1.11e-11 SMART
SPRY 353 474 6.55e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108818
SMART Domains Protein: ENSMUSP00000104446
Gene: ENSMUSG00000020490

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 150 233 3.6e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000142499
AA Change: P256S
SMART Domains Protein: ENSMUSP00000124234
Gene: ENSMUSG00000020490
AA Change: P256S

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 151 233 1e-8 PFAM
PRY 300 352 1.11e-11 SMART
SPRY 353 474 6.55e-24 SMART
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 93% (70/75)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,813,461 V150E probably benign Het
Alg11 A G 8: 22,065,841 K373E probably benign Het
Arl14ep C T 2: 106,969,053 probably benign Het
Ascc2 G A 11: 4,658,284 G227R probably benign Het
Ash1l C T 3: 89,068,993 P2627S probably damaging Het
Btla T G 16: 45,239,039 probably null Het
Cep162 C T 9: 87,204,092 A1060T probably damaging Het
Cfap54 T A 10: 93,016,524 K907* probably null Het
Chpf A T 1: 75,475,428 F461I probably damaging Het
Chrdl2 A G 7: 100,020,907 Y79C probably damaging Het
Copb2 G A 9: 98,568,108 C40Y probably benign Het
Cyfip1 T C 7: 55,925,181 L1060P probably damaging Het
Drg1 G A 11: 3,259,273 probably benign Het
Erich3 A G 3: 154,762,497 D862G possibly damaging Het
Flii G T 11: 60,716,311 Y946* probably null Het
Glt8d2 T C 10: 82,672,081 M1V probably null Het
Gm21136 T A 7: 38,867,741 noncoding transcript Het
Gramd1c T C 16: 43,992,091 T393A possibly damaging Het
Gucy2d T A 7: 98,451,883 I471N probably benign Het
Hps3 G A 3: 20,008,870 T711M probably benign Het
Hs3st4 A T 7: 123,983,608 D143V probably benign Het
Kif17 T A 4: 138,291,433 M461K possibly damaging Het
Klhdc7a T A 4: 139,967,574 S21C probably damaging Het
Klk15 G A 7: 43,938,376 R76H probably benign Het
Lnpk G A 2: 74,569,028 T57I possibly damaging Het
Ltbp2 A G 12: 84,794,063 V999A possibly damaging Het
Ltbr T C 6: 125,312,808 H141R probably damaging Het
Lvrn T C 18: 46,893,749 F805L probably damaging Het
Ms4a13 A T 19: 11,183,916 C86* probably null Het
Ncbp1 A G 4: 46,163,026 N480S probably benign Het
Nelfcd T G 2: 174,427,063 *592G probably null Het
Neurog2 T C 3: 127,634,015 V96A probably benign Het
Nod1 A T 6: 54,930,177 W902R probably benign Het
Olfr103 T C 17: 37,336,369 I288V possibly damaging Het
Olfr213 T C 6: 116,540,900 L149P probably damaging Het
Olfr543 T C 7: 102,477,750 Y40C possibly damaging Het
Olfr726 T A 14: 50,084,027 Y218F probably damaging Het
Pcdha11 A T 18: 37,007,283 H655L probably damaging Het
Plpp7 A G 2: 32,095,984 E58G probably benign Het
Psph A T 5: 129,790,621 probably benign Het
Rab11fip1 A C 8: 27,154,720 S346A probably damaging Het
Rreb1 C A 13: 37,947,408 P1513T probably benign Het
Rreb1 C T 13: 37,947,409 P1513L probably benign Het
Rsf1 C T 7: 97,685,559 R1300C probably damaging Het
Scap A G 9: 110,374,047 N263S probably benign Het
Sec24d A T 3: 123,279,312 probably benign Het
Slain2 T C 5: 72,948,545 probably benign Het
Slc6a18 G T 13: 73,668,159 T367N probably benign Het
Slk T A 19: 47,609,042 D96E probably benign Het
Spag5 G A 11: 78,313,534 V514I probably benign Het
St8sia2 T C 7: 73,966,906 D107G probably damaging Het
Tgfbr3 T A 5: 107,140,515 I427F probably benign Het
Tlr2 T G 3: 83,836,503 T758P possibly damaging Het
Tmem270 A G 5: 134,902,884 V68A probably benign Het
Vmn2r106 T A 17: 20,285,321 H37L possibly damaging Het
Vmn2r27 T G 6: 124,200,688 R452S probably damaging Het
Wdr5 A G 2: 27,533,350 Y252C probably damaging Het
Zswim9 C T 7: 13,261,445 V262M probably damaging Het
Other mutations in Btnl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Btnl10 APN 11 58919315 missense probably damaging 0.98
IGL03368:Btnl10 APN 11 58919386 missense possibly damaging 0.61
FR4304:Btnl10 UTSW 11 58923930 small insertion probably benign
FR4449:Btnl10 UTSW 11 58923928 small insertion probably benign
FR4589:Btnl10 UTSW 11 58923929 small insertion probably benign
FR4737:Btnl10 UTSW 11 58923931 small insertion probably benign
FR4976:Btnl10 UTSW 11 58923929 small insertion probably benign
R0420:Btnl10 UTSW 11 58923451 missense probably damaging 1.00
R1875:Btnl10 UTSW 11 58923760 missense probably damaging 0.97
R1908:Btnl10 UTSW 11 58920541 missense possibly damaging 0.74
R3176:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R3177:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R3276:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R3277:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R4600:Btnl10 UTSW 11 58923600 missense probably benign 0.01
R4611:Btnl10 UTSW 11 58920357 missense probably damaging 1.00
R5447:Btnl10 UTSW 11 58922318 missense probably benign 0.13
R5484:Btnl10 UTSW 11 58923825 missense probably damaging 0.98
R5787:Btnl10 UTSW 11 58920343 missense probably damaging 1.00
R5824:Btnl10 UTSW 11 58923440 missense probably benign 0.05
R6109:Btnl10 UTSW 11 58920304 missense probably damaging 0.98
R6123:Btnl10 UTSW 11 58920304 missense probably damaging 0.98
R6318:Btnl10 UTSW 11 58926865 utr 3 prime probably benign
R7064:Btnl10 UTSW 11 58919308 missense possibly damaging 0.74
R7083:Btnl10 UTSW 11 58919137 missense probably damaging 1.00
R7152:Btnl10 UTSW 11 58922397 missense probably benign
X0064:Btnl10 UTSW 11 58923610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACCCTCTTTAGAAAGGTCTAC -3'
(R):5'- TGTTGGGTGACACAAAGACAAC -3'

Sequencing Primer
(F):5'- GGTCTACCAAAAATTGTGTTCCTTG -3'
(R):5'- ACGCCTCAGAGCAGAGC -3'
Posted On2017-02-10