Incidental Mutation 'R5859:Flii'
ID455079
Institutional Source Beutler Lab
Gene Symbol Flii
Ensembl Gene ENSMUSG00000002812
Gene Nameflightless I actin binding protein
SynonymsFliih, 3632430F08Rik
MMRRC Submission 044071-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5859 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location60714123-60727263 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 60716311 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 946 (Y946*)
Ref Sequence ENSEMBL: ENSMUSP00000002889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002889] [ENSMUST00000052346] [ENSMUST00000108719]
Predicted Effect probably null
Transcript: ENSMUST00000002889
AA Change: Y946*
SMART Domains Protein: ENSMUSP00000002889
Gene: ENSMUSG00000002812
AA Change: Y946*

DomainStartEndE-ValueType
LRR 55 78 1.08e-1 SMART
LRR 103 126 4.08e0 SMART
LRR 127 149 2.27e1 SMART
LRR 150 173 1.25e-1 SMART
LRR 222 244 6.78e1 SMART
LRR 245 268 2.86e-1 SMART
LRR 269 291 3.78e-1 SMART
LRR 316 339 2.82e0 SMART
LRR 340 362 2.27e2 SMART
low complexity region 403 420 N/A INTRINSIC
GEL 499 597 4.17e-25 SMART
GEL 617 709 1.72e-26 SMART
low complexity region 727 740 N/A INTRINSIC
GEL 745 838 2.24e-25 SMART
GEL 905 1039 1.13e-3 SMART
GEL 1056 1152 7.28e-16 SMART
GEL 1167 1263 5.51e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052346
SMART Domains Protein: ENSMUSP00000060749
Gene: ENSMUSG00000020536

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 278 379 1.2e-43 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 541 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 732 978 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108719
SMART Domains Protein: ENSMUSP00000104359
Gene: ENSMUSG00000020536

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 275 379 2e-48 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 540 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 804 976 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154465
Meta Mutation Damage Score 0.58 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: This gene encodes a protein with gelsolin-like repeats and an N-terminal leucine-rich repeat domain. The protein is similar to a Drosophila protein involved in early embryogenesis and the structural organization of indirect flight muscle. This protein may act as an actin-remodelling protein as well as a transcriptional coactivator. Homozygous knockout mice show embryonic lethality. This protein may act to regulate wound repair. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Embryos homozygous for a knock-out allele are able to initiate uterine implantation but degenerate rapidly thereafter. Heterozygous mutant mice display enhanced wound healing with increased epithelial migration and improved wound contraction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,813,461 V150E probably benign Het
Alg11 A G 8: 22,065,841 K373E probably benign Het
Arl14ep C T 2: 106,969,053 probably benign Het
Ascc2 G A 11: 4,658,284 G227R probably benign Het
Ash1l C T 3: 89,068,993 P2627S probably damaging Het
Btla T G 16: 45,239,039 probably null Het
Btnl10 C T 11: 58,922,312 P256S probably benign Het
Cep162 C T 9: 87,204,092 A1060T probably damaging Het
Cfap54 T A 10: 93,016,524 K907* probably null Het
Chpf A T 1: 75,475,428 F461I probably damaging Het
Chrdl2 A G 7: 100,020,907 Y79C probably damaging Het
Copb2 G A 9: 98,568,108 C40Y probably benign Het
Cyfip1 T C 7: 55,925,181 L1060P probably damaging Het
Drg1 G A 11: 3,259,273 probably benign Het
Erich3 A G 3: 154,762,497 D862G possibly damaging Het
Glt8d2 T C 10: 82,672,081 M1V probably null Het
Gm21136 T A 7: 38,867,741 noncoding transcript Het
Gramd1c T C 16: 43,992,091 T393A possibly damaging Het
Gucy2d T A 7: 98,451,883 I471N probably benign Het
Hps3 G A 3: 20,008,870 T711M probably benign Het
Hs3st4 A T 7: 123,983,608 D143V probably benign Het
Kif17 T A 4: 138,291,433 M461K possibly damaging Het
Klhdc7a T A 4: 139,967,574 S21C probably damaging Het
Klk15 G A 7: 43,938,376 R76H probably benign Het
Lnpk G A 2: 74,569,028 T57I possibly damaging Het
Ltbp2 A G 12: 84,794,063 V999A possibly damaging Het
Ltbr T C 6: 125,312,808 H141R probably damaging Het
Lvrn T C 18: 46,893,749 F805L probably damaging Het
Ms4a13 A T 19: 11,183,916 C86* probably null Het
Ncbp1 A G 4: 46,163,026 N480S probably benign Het
Nelfcd T G 2: 174,427,063 *592G probably null Het
Neurog2 T C 3: 127,634,015 V96A probably benign Het
Nod1 A T 6: 54,930,177 W902R probably benign Het
Olfr103 T C 17: 37,336,369 I288V possibly damaging Het
Olfr213 T C 6: 116,540,900 L149P probably damaging Het
Olfr543 T C 7: 102,477,750 Y40C possibly damaging Het
Olfr726 T A 14: 50,084,027 Y218F probably damaging Het
Pcdha11 A T 18: 37,007,283 H655L probably damaging Het
Plpp7 A G 2: 32,095,984 E58G probably benign Het
Psph A T 5: 129,790,621 probably benign Het
Rab11fip1 A C 8: 27,154,720 S346A probably damaging Het
Rreb1 C A 13: 37,947,408 P1513T probably benign Het
Rreb1 C T 13: 37,947,409 P1513L probably benign Het
Rsf1 C T 7: 97,685,559 R1300C probably damaging Het
Scap A G 9: 110,374,047 N263S probably benign Het
Sec24d A T 3: 123,279,312 probably benign Het
Slain2 T C 5: 72,948,545 probably benign Het
Slc6a18 G T 13: 73,668,159 T367N probably benign Het
Slk T A 19: 47,609,042 D96E probably benign Het
Spag5 G A 11: 78,313,534 V514I probably benign Het
St8sia2 T C 7: 73,966,906 D107G probably damaging Het
Tgfbr3 T A 5: 107,140,515 I427F probably benign Het
Tlr2 T G 3: 83,836,503 T758P possibly damaging Het
Tmem270 A G 5: 134,902,884 V68A probably benign Het
Vmn2r106 T A 17: 20,285,321 H37L possibly damaging Het
Vmn2r27 T G 6: 124,200,688 R452S probably damaging Het
Wdr5 A G 2: 27,533,350 Y252C probably damaging Het
Zswim9 C T 7: 13,261,445 V262M probably damaging Het
Other mutations in Flii
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Flii APN 11 60723415 missense probably benign 0.03
IGL00331:Flii APN 11 60715833 missense probably benign 0.40
IGL01530:Flii APN 11 60720182 nonsense probably null
IGL01678:Flii APN 11 60716846 unclassified probably benign
IGL01938:Flii APN 11 60715116 missense probably damaging 1.00
IGL02211:Flii APN 11 60718298 unclassified probably benign
IGL02626:Flii APN 11 60719859 missense probably benign 0.37
IGL03038:Flii APN 11 60724832 missense probably benign 0.01
IGL03412:Flii APN 11 60722640 missense probably damaging 0.99
Dry_tortugas UTSW 11 60720757 nonsense probably null
R0135:Flii UTSW 11 60723378 missense probably damaging 0.99
R0350:Flii UTSW 11 60721857 missense probably damaging 1.00
R0355:Flii UTSW 11 60719680 splice site probably null
R0524:Flii UTSW 11 60720061 missense probably damaging 0.98
R0636:Flii UTSW 11 60715552 missense probably damaging 1.00
R0639:Flii UTSW 11 60722997 splice site probably null
R1515:Flii UTSW 11 60721606 critical splice acceptor site probably null
R1544:Flii UTSW 11 60719692 critical splice donor site probably null
R1782:Flii UTSW 11 60714636 missense probably benign
R2922:Flii UTSW 11 60718916 missense probably damaging 1.00
R3691:Flii UTSW 11 60719757 missense probably benign 0.03
R3753:Flii UTSW 11 60715480 missense probably benign
R3875:Flii UTSW 11 60720492 missense probably benign
R3876:Flii UTSW 11 60719872 missense possibly damaging 0.85
R3924:Flii UTSW 11 60720076 missense probably damaging 1.00
R4621:Flii UTSW 11 60716111 missense possibly damaging 0.95
R4789:Flii UTSW 11 60715093 missense probably benign 0.33
R5153:Flii UTSW 11 60716686 missense possibly damaging 0.89
R5326:Flii UTSW 11 60718862 missense probably benign 0.30
R5340:Flii UTSW 11 60717268 missense probably damaging 0.99
R5364:Flii UTSW 11 60720128 missense probably benign 0.00
R5542:Flii UTSW 11 60718862 missense probably benign 0.30
R5592:Flii UTSW 11 60720399 missense probably benign 0.00
R5968:Flii UTSW 11 60720212 missense probably benign
R6009:Flii UTSW 11 60720757 nonsense probably null
R6287:Flii UTSW 11 60721597 missense probably damaging 1.00
R6368:Flii UTSW 11 60721136 missense probably damaging 1.00
R6997:Flii UTSW 11 60722325 missense probably benign 0.14
R7099:Flii UTSW 11 60720655 missense probably benign 0.05
X0025:Flii UTSW 11 60721708 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AATGTGAAGGTCAGCCAGC -3'
(R):5'- TGATGACGGCTAACAGGCAG -3'

Sequencing Primer
(F):5'- TCAGCCAGCCCATGTTG -3'
(R):5'- TGAGGACCTGGATGGCATG -3'
Posted On2017-02-10