Incidental Mutation 'R5859:Slc6a18'
ID455084
Institutional Source Beutler Lab
Gene Symbol Slc6a18
Ensembl Gene ENSMUSG00000021612
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 18
SynonymsXtrp2, D630001K16Rik, XT2
MMRRC Submission 044071-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5859 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location73661752-73678023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73668159 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 367 (T367N)
Ref Sequence ENSEMBL: ENSMUSP00000152146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022105] [ENSMUST00000109679] [ENSMUST00000109680] [ENSMUST00000220650] [ENSMUST00000222029] [ENSMUST00000223026] [ENSMUST00000223074]
Predicted Effect probably benign
Transcript: ENSMUST00000022105
AA Change: T367N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000022105
Gene: ENSMUSG00000021612
AA Change: T367N

DomainStartEndE-ValueType
Pfam:SNF 17 593 2.1e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109679
AA Change: T367N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105301
Gene: ENSMUSG00000021612
AA Change: T367N

DomainStartEndE-ValueType
Pfam:SNF 17 511 6.8e-164 PFAM
low complexity region 513 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109680
AA Change: T367N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105302
Gene: ENSMUSG00000021612
AA Change: T367N

DomainStartEndE-ValueType
Pfam:SNF 17 325 2.1e-126 PFAM
Pfam:SNF 392 555 9.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220650
AA Change: T367N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000220703
Predicted Effect probably benign
Transcript: ENSMUST00000222029
AA Change: T367N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000223026
AA Change: T367N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000223074
AA Change: T367N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.1184 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SLC6 family of proteins, which includes SLC6A18, act as specific transporters for neurotransmitters, amino acids, and osmolytes like betaine, taurine, and creatine. SLC6 proteins are sodium cotransporters that derive the energy for solute transport from the electrochemical gradient for sodium ions (Hoglund et al., 2005 [PubMed 16125675]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Homozygous null mice are overtly normal but have increased blood pressure associated with impaired renal accumulation of glycine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,813,461 V150E probably benign Het
Alg11 A G 8: 22,065,841 K373E probably benign Het
Arl14ep C T 2: 106,969,053 probably benign Het
Ascc2 G A 11: 4,658,284 G227R probably benign Het
Ash1l C T 3: 89,068,993 P2627S probably damaging Het
Btla T G 16: 45,239,039 probably null Het
Btnl10 C T 11: 58,922,312 P256S probably benign Het
Cep162 C T 9: 87,204,092 A1060T probably damaging Het
Cfap54 T A 10: 93,016,524 K907* probably null Het
Chpf A T 1: 75,475,428 F461I probably damaging Het
Chrdl2 A G 7: 100,020,907 Y79C probably damaging Het
Copb2 G A 9: 98,568,108 C40Y probably benign Het
Cyfip1 T C 7: 55,925,181 L1060P probably damaging Het
Drg1 G A 11: 3,259,273 probably benign Het
Erich3 A G 3: 154,762,497 D862G possibly damaging Het
Flii G T 11: 60,716,311 Y946* probably null Het
Glt8d2 T C 10: 82,672,081 M1V probably null Het
Gm21136 T A 7: 38,867,741 noncoding transcript Het
Gramd1c T C 16: 43,992,091 T393A possibly damaging Het
Gucy2d T A 7: 98,451,883 I471N probably benign Het
Hps3 G A 3: 20,008,870 T711M probably benign Het
Hs3st4 A T 7: 123,983,608 D143V probably benign Het
Kif17 T A 4: 138,291,433 M461K possibly damaging Het
Klhdc7a T A 4: 139,967,574 S21C probably damaging Het
Klk15 G A 7: 43,938,376 R76H probably benign Het
Lnpk G A 2: 74,569,028 T57I possibly damaging Het
Ltbp2 A G 12: 84,794,063 V999A possibly damaging Het
Ltbr T C 6: 125,312,808 H141R probably damaging Het
Lvrn T C 18: 46,893,749 F805L probably damaging Het
Ms4a13 A T 19: 11,183,916 C86* probably null Het
Ncbp1 A G 4: 46,163,026 N480S probably benign Het
Nelfcd T G 2: 174,427,063 *592G probably null Het
Neurog2 T C 3: 127,634,015 V96A probably benign Het
Nod1 A T 6: 54,930,177 W902R probably benign Het
Olfr103 T C 17: 37,336,369 I288V possibly damaging Het
Olfr213 T C 6: 116,540,900 L149P probably damaging Het
Olfr543 T C 7: 102,477,750 Y40C possibly damaging Het
Olfr726 T A 14: 50,084,027 Y218F probably damaging Het
Pcdha11 A T 18: 37,007,283 H655L probably damaging Het
Plpp7 A G 2: 32,095,984 E58G probably benign Het
Psph A T 5: 129,790,621 probably benign Het
Rab11fip1 A C 8: 27,154,720 S346A probably damaging Het
Rreb1 C A 13: 37,947,408 P1513T probably benign Het
Rreb1 C T 13: 37,947,409 P1513L probably benign Het
Rsf1 C T 7: 97,685,559 R1300C probably damaging Het
Scap A G 9: 110,374,047 N263S probably benign Het
Sec24d A T 3: 123,279,312 probably benign Het
Slain2 T C 5: 72,948,545 probably benign Het
Slk T A 19: 47,609,042 D96E probably benign Het
Spag5 G A 11: 78,313,534 V514I probably benign Het
St8sia2 T C 7: 73,966,906 D107G probably damaging Het
Tgfbr3 T A 5: 107,140,515 I427F probably benign Het
Tlr2 T G 3: 83,836,503 T758P possibly damaging Het
Tmem270 A G 5: 134,902,884 V68A probably benign Het
Vmn2r106 T A 17: 20,285,321 H37L possibly damaging Het
Vmn2r27 T G 6: 124,200,688 R452S probably damaging Het
Wdr5 A G 2: 27,533,350 Y252C probably damaging Het
Zswim9 C T 7: 13,261,445 V262M probably damaging Het
Other mutations in Slc6a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Slc6a18 APN 13 73671719 missense possibly damaging 0.82
IGL01370:Slc6a18 APN 13 73667031 missense probably damaging 1.00
IGL01959:Slc6a18 APN 13 73677865 missense probably damaging 1.00
IGL02096:Slc6a18 APN 13 73672751 missense probably benign 0.05
IGL02147:Slc6a18 APN 13 73668162 missense probably damaging 0.97
IGL02167:Slc6a18 APN 13 73666472 critical splice acceptor site probably null
IGL02465:Slc6a18 APN 13 73677785 missense probably benign 0.11
IGL02548:Slc6a18 APN 13 73669995 missense probably damaging 1.00
IGL02720:Slc6a18 APN 13 73669968 missense probably benign 0.16
IGL03341:Slc6a18 APN 13 73677923 missense probably benign 0.07
R0011:Slc6a18 UTSW 13 73665619 missense possibly damaging 0.59
R0219:Slc6a18 UTSW 13 73674632 splice site probably null
R0884:Slc6a18 UTSW 13 73667037 missense probably damaging 1.00
R1019:Slc6a18 UTSW 13 73677879 missense probably damaging 1.00
R1610:Slc6a18 UTSW 13 73668225 missense probably benign 0.10
R1901:Slc6a18 UTSW 13 73670043 missense probably benign 0.39
R1969:Slc6a18 UTSW 13 73664189 missense possibly damaging 0.66
R2014:Slc6a18 UTSW 13 73675725 missense probably benign 0.02
R2445:Slc6a18 UTSW 13 73666752 nonsense probably null
R2504:Slc6a18 UTSW 13 73675806 missense probably benign 0.01
R3125:Slc6a18 UTSW 13 73677802 missense probably damaging 1.00
R4084:Slc6a18 UTSW 13 73667029 missense probably benign 0.39
R4571:Slc6a18 UTSW 13 73666370 missense possibly damaging 0.59
R4735:Slc6a18 UTSW 13 73666435 missense probably benign 0.42
R5032:Slc6a18 UTSW 13 73666323 missense probably damaging 1.00
R6258:Slc6a18 UTSW 13 73670045 nonsense probably null
R6350:Slc6a18 UTSW 13 73677925 missense possibly damaging 0.80
R6370:Slc6a18 UTSW 13 73668159 missense probably benign 0.21
R6640:Slc6a18 UTSW 13 73664282 missense possibly damaging 0.95
R6747:Slc6a18 UTSW 13 73677991 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ATTCTGAGGTCATCCTGTCTGC -3'
(R):5'- TTGCTCGAGAACTTTCCTGG -3'

Sequencing Primer
(F):5'- AGGTCATCCTGTCTGCCAGATG -3'
(R):5'- CTCGAGAACTTTCCTGGAATACTGG -3'
Posted On2017-02-10