Incidental Mutation 'R5859:Btla'
ID455087
Institutional Source Beutler Lab
Gene Symbol Btla
Ensembl Gene ENSMUSG00000052013
Gene NameB and T lymphocyte associated
Synonyms
MMRRC Submission 044071-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.017) question?
Stock #R5859 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location45224315-45257670 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 45239039 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063654] [ENSMUST00000102802]
Predicted Effect probably null
Transcript: ENSMUST00000063654
SMART Domains Protein: ENSMUSP00000067877
Gene: ENSMUSG00000052013

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IG 49 143 2.92e-5 SMART
transmembrane domain 182 204 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102802
SMART Domains Protein: ENSMUSP00000099866
Gene: ENSMUSG00000052013

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IG 49 143 2.92e-5 SMART
transmembrane domain 181 203 N/A INTRINSIC
Meta Mutation Damage Score 0.6276 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded protein contains a single immunoglobulin (Ig) domain and is a receptor that relays inhibitory signals to suppress the immune response. Alternative splicing results in multiple transcript variants. Polymorphisms in this gene have been associated with an increased risk of rheumatoid arthritis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Targeted inactivation of this gene leads to increased T cell activation. Homozygotes for a null allele show altered peripheral T cell anergy. Homozygotes for a different null allele show enhanced specific antibody responses, increased susceptibility to EAE, and prolonged allograft survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,813,461 V150E probably benign Het
Alg11 A G 8: 22,065,841 K373E probably benign Het
Arl14ep C T 2: 106,969,053 probably benign Het
Ascc2 G A 11: 4,658,284 G227R probably benign Het
Ash1l C T 3: 89,068,993 P2627S probably damaging Het
Btnl10 C T 11: 58,922,312 P256S probably benign Het
Cep162 C T 9: 87,204,092 A1060T probably damaging Het
Cfap54 T A 10: 93,016,524 K907* probably null Het
Chpf A T 1: 75,475,428 F461I probably damaging Het
Chrdl2 A G 7: 100,020,907 Y79C probably damaging Het
Copb2 G A 9: 98,568,108 C40Y probably benign Het
Cyfip1 T C 7: 55,925,181 L1060P probably damaging Het
Drg1 G A 11: 3,259,273 probably benign Het
Erich3 A G 3: 154,762,497 D862G possibly damaging Het
Flii G T 11: 60,716,311 Y946* probably null Het
Glt8d2 T C 10: 82,672,081 M1V probably null Het
Gm21136 T A 7: 38,867,741 noncoding transcript Het
Gramd1c T C 16: 43,992,091 T393A possibly damaging Het
Gucy2d T A 7: 98,451,883 I471N probably benign Het
Hps3 G A 3: 20,008,870 T711M probably benign Het
Hs3st4 A T 7: 123,983,608 D143V probably benign Het
Kif17 T A 4: 138,291,433 M461K possibly damaging Het
Klhdc7a T A 4: 139,967,574 S21C probably damaging Het
Klk15 G A 7: 43,938,376 R76H probably benign Het
Lnpk G A 2: 74,569,028 T57I possibly damaging Het
Ltbp2 A G 12: 84,794,063 V999A possibly damaging Het
Ltbr T C 6: 125,312,808 H141R probably damaging Het
Lvrn T C 18: 46,893,749 F805L probably damaging Het
Ms4a13 A T 19: 11,183,916 C86* probably null Het
Ncbp1 A G 4: 46,163,026 N480S probably benign Het
Nelfcd T G 2: 174,427,063 *592G probably null Het
Neurog2 T C 3: 127,634,015 V96A probably benign Het
Nod1 A T 6: 54,930,177 W902R probably benign Het
Olfr103 T C 17: 37,336,369 I288V possibly damaging Het
Olfr213 T C 6: 116,540,900 L149P probably damaging Het
Olfr543 T C 7: 102,477,750 Y40C possibly damaging Het
Olfr726 T A 14: 50,084,027 Y218F probably damaging Het
Pcdha11 A T 18: 37,007,283 H655L probably damaging Het
Plpp7 A G 2: 32,095,984 E58G probably benign Het
Psph A T 5: 129,790,621 probably benign Het
Rab11fip1 A C 8: 27,154,720 S346A probably damaging Het
Rreb1 C A 13: 37,947,408 P1513T probably benign Het
Rreb1 C T 13: 37,947,409 P1513L probably benign Het
Rsf1 C T 7: 97,685,559 R1300C probably damaging Het
Scap A G 9: 110,374,047 N263S probably benign Het
Sec24d A T 3: 123,279,312 probably benign Het
Slain2 T C 5: 72,948,545 probably benign Het
Slc6a18 G T 13: 73,668,159 T367N probably benign Het
Slk T A 19: 47,609,042 D96E probably benign Het
Spag5 G A 11: 78,313,534 V514I probably benign Het
St8sia2 T C 7: 73,966,906 D107G probably damaging Het
Tgfbr3 T A 5: 107,140,515 I427F probably benign Het
Tlr2 T G 3: 83,836,503 T758P possibly damaging Het
Tmem270 A G 5: 134,902,884 V68A probably benign Het
Vmn2r106 T A 17: 20,285,321 H37L possibly damaging Het
Vmn2r27 T G 6: 124,200,688 R452S probably damaging Het
Wdr5 A G 2: 27,533,350 Y252C probably damaging Het
Zswim9 C T 7: 13,261,445 V262M probably damaging Het
Other mutations in Btla
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Btla APN 16 45250353 missense probably benign 0.34
IGL01774:Btla APN 16 45250548 missense possibly damaging 0.78
IGL03252:Btla APN 16 45239146 missense possibly damaging 0.56
IGL03266:Btla APN 16 45239275 missense probably damaging 0.98
Conundrum UTSW 16 45239298 missense probably damaging 1.00
Enigmatic UTSW 16 45239039 splice site probably null
Mysterious UTSW 16 45250573 nonsense probably null
R1373:Btla UTSW 16 45224420 missense probably benign 0.09
R1864:Btla UTSW 16 45250374 missense probably damaging 0.97
R2439:Btla UTSW 16 45239140 missense probably damaging 1.00
R4133:Btla UTSW 16 45239298 missense probably damaging 1.00
R4193:Btla UTSW 16 45250482 missense probably benign 0.00
R4948:Btla UTSW 16 45242728 missense probably benign 0.33
R5597:Btla UTSW 16 45244236 missense probably benign
R5666:Btla UTSW 16 45250419 missense probably damaging 1.00
R5670:Btla UTSW 16 45250419 missense probably damaging 1.00
R5700:Btla UTSW 16 45250573 nonsense probably null
R6442:Btla UTSW 16 45224458 missense probably benign 0.00
R6442:Btla UTSW 16 45250350 missense possibly damaging 0.82
R6526:Btla UTSW 16 45239094 missense probably damaging 1.00
R6883:Btla UTSW 16 45242729 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGCAAGCATTTATTACGTGACAG -3'
(R):5'- GACCCATTATCACTGAGATGTATTG -3'

Sequencing Primer
(F):5'- ACGTGACAGTTGTGTACCAC -3'
(R):5'- CTTCCCAACTAGTGTATAGCTGAGG -3'
Posted On2017-02-10