Incidental Mutation 'R5859:Lvrn'
ID455092
Institutional Source Beutler Lab
Gene Symbol Lvrn
Ensembl Gene ENSMUSG00000024481
Gene Namelaeverin
Synonyms4833403I15Rik, Aqpep
MMRRC Submission 044071-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R5859 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location46850039-46905446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46893749 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 805 (F805L)
Ref Sequence ENSEMBL: ENSMUSP00000025358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025358]
Predicted Effect probably damaging
Transcript: ENSMUST00000025358
AA Change: F805L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025358
Gene: ENSMUSG00000024481
AA Change: F805L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Peptidase_M1 94 504 1.6e-110 PFAM
Pfam:ERAP1_C 645 968 2.5e-60 PFAM
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 93% (70/75)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,813,461 V150E probably benign Het
Alg11 A G 8: 22,065,841 K373E probably benign Het
Arl14ep C T 2: 106,969,053 probably benign Het
Ascc2 G A 11: 4,658,284 G227R probably benign Het
Ash1l C T 3: 89,068,993 P2627S probably damaging Het
Btla T G 16: 45,239,039 probably null Het
Btnl10 C T 11: 58,922,312 P256S probably benign Het
Cep162 C T 9: 87,204,092 A1060T probably damaging Het
Cfap54 T A 10: 93,016,524 K907* probably null Het
Chpf A T 1: 75,475,428 F461I probably damaging Het
Chrdl2 A G 7: 100,020,907 Y79C probably damaging Het
Copb2 G A 9: 98,568,108 C40Y probably benign Het
Cyfip1 T C 7: 55,925,181 L1060P probably damaging Het
Drg1 G A 11: 3,259,273 probably benign Het
Erich3 A G 3: 154,762,497 D862G possibly damaging Het
Flii G T 11: 60,716,311 Y946* probably null Het
Glt8d2 T C 10: 82,672,081 M1V probably null Het
Gm21136 T A 7: 38,867,741 noncoding transcript Het
Gramd1c T C 16: 43,992,091 T393A possibly damaging Het
Gucy2d T A 7: 98,451,883 I471N probably benign Het
Hps3 G A 3: 20,008,870 T711M probably benign Het
Hs3st4 A T 7: 123,983,608 D143V probably benign Het
Kif17 T A 4: 138,291,433 M461K possibly damaging Het
Klhdc7a T A 4: 139,967,574 S21C probably damaging Het
Klk15 G A 7: 43,938,376 R76H probably benign Het
Lnpk G A 2: 74,569,028 T57I possibly damaging Het
Ltbp2 A G 12: 84,794,063 V999A possibly damaging Het
Ltbr T C 6: 125,312,808 H141R probably damaging Het
Ms4a13 A T 19: 11,183,916 C86* probably null Het
Ncbp1 A G 4: 46,163,026 N480S probably benign Het
Nelfcd T G 2: 174,427,063 *592G probably null Het
Neurog2 T C 3: 127,634,015 V96A probably benign Het
Nod1 A T 6: 54,930,177 W902R probably benign Het
Olfr103 T C 17: 37,336,369 I288V possibly damaging Het
Olfr213 T C 6: 116,540,900 L149P probably damaging Het
Olfr543 T C 7: 102,477,750 Y40C possibly damaging Het
Olfr726 T A 14: 50,084,027 Y218F probably damaging Het
Pcdha11 A T 18: 37,007,283 H655L probably damaging Het
Plpp7 A G 2: 32,095,984 E58G probably benign Het
Psph A T 5: 129,790,621 probably benign Het
Rab11fip1 A C 8: 27,154,720 S346A probably damaging Het
Rreb1 C A 13: 37,947,408 P1513T probably benign Het
Rreb1 C T 13: 37,947,409 P1513L probably benign Het
Rsf1 C T 7: 97,685,559 R1300C probably damaging Het
Scap A G 9: 110,374,047 N263S probably benign Het
Sec24d A T 3: 123,279,312 probably benign Het
Slain2 T C 5: 72,948,545 probably benign Het
Slc6a18 G T 13: 73,668,159 T367N probably benign Het
Slk T A 19: 47,609,042 D96E probably benign Het
Spag5 G A 11: 78,313,534 V514I probably benign Het
St8sia2 T C 7: 73,966,906 D107G probably damaging Het
Tgfbr3 T A 5: 107,140,515 I427F probably benign Het
Tlr2 T G 3: 83,836,503 T758P possibly damaging Het
Tmem270 A G 5: 134,902,884 V68A probably benign Het
Vmn2r106 T A 17: 20,285,321 H37L possibly damaging Het
Vmn2r27 T G 6: 124,200,688 R452S probably damaging Het
Wdr5 A G 2: 27,533,350 Y252C probably damaging Het
Zswim9 C T 7: 13,261,445 V262M probably damaging Het
Other mutations in Lvrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Lvrn APN 18 46864666 splice site probably benign
IGL01532:Lvrn APN 18 46900484 missense probably damaging 1.00
IGL02430:Lvrn APN 18 46894730 missense probably benign 0.03
IGL02573:Lvrn APN 18 46876949 missense probably damaging 0.98
IGL02592:Lvrn APN 18 46850591 missense probably damaging 1.00
IGL02754:Lvrn APN 18 46890904 nonsense probably null
IGL03089:Lvrn APN 18 46880709 missense probably damaging 0.99
IGL03209:Lvrn APN 18 46889498 missense probably benign 0.00
IGL03333:Lvrn APN 18 46864664 splice site probably benign
IGL03098:Lvrn UTSW 18 46881410 critical splice acceptor site probably null
R0319:Lvrn UTSW 18 46864753 missense probably damaging 1.00
R0391:Lvrn UTSW 18 46850466 missense probably benign 0.01
R0398:Lvrn UTSW 18 46880693 missense probably benign 0.06
R0432:Lvrn UTSW 18 46905299 missense possibly damaging 0.94
R0456:Lvrn UTSW 18 46864816 critical splice donor site probably null
R1458:Lvrn UTSW 18 46882385 splice site probably benign
R1612:Lvrn UTSW 18 46894703 missense probably damaging 0.99
R1935:Lvrn UTSW 18 46878320 missense probably benign 0.10
R1936:Lvrn UTSW 18 46878320 missense probably benign 0.10
R1959:Lvrn UTSW 18 46894717 missense probably damaging 1.00
R2000:Lvrn UTSW 18 46905307 missense probably benign 0.04
R2022:Lvrn UTSW 18 46866436 missense possibly damaging 0.81
R2106:Lvrn UTSW 18 46878289 missense probably damaging 1.00
R2197:Lvrn UTSW 18 46878342 missense probably benign 0.03
R2371:Lvrn UTSW 18 46878163 intron probably null
R4125:Lvrn UTSW 18 46876969 missense possibly damaging 0.53
R4606:Lvrn UTSW 18 46864765 missense possibly damaging 0.92
R4830:Lvrn UTSW 18 46905351 missense probably damaging 1.00
R4866:Lvrn UTSW 18 46893701 missense probably damaging 1.00
R4900:Lvrn UTSW 18 46893701 missense probably damaging 1.00
R4900:Lvrn UTSW 18 46881412 missense probably damaging 1.00
R4924:Lvrn UTSW 18 46894725 missense probably damaging 1.00
R4948:Lvrn UTSW 18 46880736 missense probably damaging 1.00
R5167:Lvrn UTSW 18 46880747 missense probably damaging 0.99
R5527:Lvrn UTSW 18 46873803 missense probably damaging 1.00
R5581:Lvrn UTSW 18 46890865 missense probably benign 0.17
R5615:Lvrn UTSW 18 46850328 missense possibly damaging 0.55
R6149:Lvrn UTSW 18 46884432 missense probably benign 0.10
R6183:Lvrn UTSW 18 46850685 missense probably benign 0.14
R6378:Lvrn UTSW 18 46894957 missense probably benign 0.00
R6838:Lvrn UTSW 18 46890880 missense possibly damaging 0.88
R6993:Lvrn UTSW 18 46882298 missense probably benign 0.18
R7017:Lvrn UTSW 18 46850678 missense probably benign 0.00
R7168:Lvrn UTSW 18 46881322 missense probably benign 0.29
R7190:Lvrn UTSW 18 46900503 missense probably benign 0.02
R7315:Lvrn UTSW 18 46876984 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AGGGGATGTTTGAAAATTCTCACTG -3'
(R):5'- AGTTCTAATCTGCCACGCCC -3'

Sequencing Primer
(F):5'- GAAAATTCTCACTGTTTTGTGAACC -3'
(R):5'- GCCCACAACTGACTTAGATAATGG -3'
Posted On2017-02-10