Incidental Mutation 'R5859:Slk'
ID455094
Institutional Source Beutler Lab
Gene Symbol Slk
Ensembl Gene ENSMUSG00000025060
Gene NameSTE20-like kinase
Synonyms9A2, Stk2, mSLK, Etk4, SLK
MMRRC Submission 044071-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5859 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47579678-47645246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47609042 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 96 (D96E)
Ref Sequence ENSEMBL: ENSMUSP00000026043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026043] [ENSMUST00000051691]
Predicted Effect probably benign
Transcript: ENSMUST00000026043
AA Change: D96E

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026043
Gene: ENSMUSG00000025060
AA Change: D96E

DomainStartEndE-ValueType
S_TKc 34 292 3.18e-99 SMART
low complexity region 305 328 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 585 600 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
Pfam:PKK 849 928 1.2e-19 PFAM
Pfam:PKK 986 1127 7.4e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051691
AA Change: D96E

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049977
Gene: ENSMUSG00000025060
AA Change: D96E

DomainStartEndE-ValueType
S_TKc 34 292 3.18e-99 SMART
low complexity region 305 328 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 585 600 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
Pfam:PKK 850 988 1.6e-40 PFAM
Pfam:PKK 1018 1158 1.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136557
Meta Mutation Damage Score 0.292 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 93% (70/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele die by E14.5, exhibiting severe developmental defects, impaired neuronal and skeletal muscle development, abnormal placental differentiation and vascularization, and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,813,461 V150E probably benign Het
Alg11 A G 8: 22,065,841 K373E probably benign Het
Arl14ep C T 2: 106,969,053 probably benign Het
Ascc2 G A 11: 4,658,284 G227R probably benign Het
Ash1l C T 3: 89,068,993 P2627S probably damaging Het
Btla T G 16: 45,239,039 probably null Het
Btnl10 C T 11: 58,922,312 P256S probably benign Het
Cep162 C T 9: 87,204,092 A1060T probably damaging Het
Cfap54 T A 10: 93,016,524 K907* probably null Het
Chpf A T 1: 75,475,428 F461I probably damaging Het
Chrdl2 A G 7: 100,020,907 Y79C probably damaging Het
Copb2 G A 9: 98,568,108 C40Y probably benign Het
Cyfip1 T C 7: 55,925,181 L1060P probably damaging Het
Drg1 G A 11: 3,259,273 probably benign Het
Erich3 A G 3: 154,762,497 D862G possibly damaging Het
Flii G T 11: 60,716,311 Y946* probably null Het
Glt8d2 T C 10: 82,672,081 M1V probably null Het
Gm21136 T A 7: 38,867,741 noncoding transcript Het
Gramd1c T C 16: 43,992,091 T393A possibly damaging Het
Gucy2d T A 7: 98,451,883 I471N probably benign Het
Hps3 G A 3: 20,008,870 T711M probably benign Het
Hs3st4 A T 7: 123,983,608 D143V probably benign Het
Kif17 T A 4: 138,291,433 M461K possibly damaging Het
Klhdc7a T A 4: 139,967,574 S21C probably damaging Het
Klk15 G A 7: 43,938,376 R76H probably benign Het
Lnpk G A 2: 74,569,028 T57I possibly damaging Het
Ltbp2 A G 12: 84,794,063 V999A possibly damaging Het
Ltbr T C 6: 125,312,808 H141R probably damaging Het
Lvrn T C 18: 46,893,749 F805L probably damaging Het
Ms4a13 A T 19: 11,183,916 C86* probably null Het
Ncbp1 A G 4: 46,163,026 N480S probably benign Het
Nelfcd T G 2: 174,427,063 *592G probably null Het
Neurog2 T C 3: 127,634,015 V96A probably benign Het
Nod1 A T 6: 54,930,177 W902R probably benign Het
Olfr103 T C 17: 37,336,369 I288V possibly damaging Het
Olfr213 T C 6: 116,540,900 L149P probably damaging Het
Olfr543 T C 7: 102,477,750 Y40C possibly damaging Het
Olfr726 T A 14: 50,084,027 Y218F probably damaging Het
Pcdha11 A T 18: 37,007,283 H655L probably damaging Het
Plpp7 A G 2: 32,095,984 E58G probably benign Het
Psph A T 5: 129,790,621 probably benign Het
Rab11fip1 A C 8: 27,154,720 S346A probably damaging Het
Rreb1 C A 13: 37,947,408 P1513T probably benign Het
Rreb1 C T 13: 37,947,409 P1513L probably benign Het
Rsf1 C T 7: 97,685,559 R1300C probably damaging Het
Scap A G 9: 110,374,047 N263S probably benign Het
Sec24d A T 3: 123,279,312 probably benign Het
Slain2 T C 5: 72,948,545 probably benign Het
Slc6a18 G T 13: 73,668,159 T367N probably benign Het
Spag5 G A 11: 78,313,534 V514I probably benign Het
St8sia2 T C 7: 73,966,906 D107G probably damaging Het
Tgfbr3 T A 5: 107,140,515 I427F probably benign Het
Tlr2 T G 3: 83,836,503 T758P possibly damaging Het
Tmem270 A G 5: 134,902,884 V68A probably benign Het
Vmn2r106 T A 17: 20,285,321 H37L possibly damaging Het
Vmn2r27 T G 6: 124,200,688 R452S probably damaging Het
Wdr5 A G 2: 27,533,350 Y252C probably damaging Het
Zswim9 C T 7: 13,261,445 V262M probably damaging Het
Other mutations in Slk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Slk APN 19 47619709 missense probably benign 0.00
IGL00515:Slk APN 19 47642096 unclassified probably benign
IGL00755:Slk APN 19 47609010 missense probably damaging 0.99
IGL00990:Slk APN 19 47580252 missense probably damaging 0.98
IGL02283:Slk APN 19 47641993 missense probably damaging 1.00
R0140:Slk UTSW 19 47622335 missense probably damaging 1.00
R0364:Slk UTSW 19 47620189 nonsense probably null
R0944:Slk UTSW 19 47608993 missense probably damaging 1.00
R1756:Slk UTSW 19 47622677 missense probably damaging 0.97
R1795:Slk UTSW 19 47620534 missense possibly damaging 0.72
R1869:Slk UTSW 19 47625452 missense probably damaging 1.00
R1980:Slk UTSW 19 47611989 missense probably damaging 1.00
R2261:Slk UTSW 19 47637352 missense probably damaging 0.99
R2278:Slk UTSW 19 47619749 missense probably damaging 0.97
R3746:Slk UTSW 19 47619809 missense possibly damaging 0.88
R3748:Slk UTSW 19 47619809 missense possibly damaging 0.88
R3749:Slk UTSW 19 47619809 missense possibly damaging 0.88
R3750:Slk UTSW 19 47619809 missense possibly damaging 0.88
R4024:Slk UTSW 19 47622370 splice site probably null
R4471:Slk UTSW 19 47615423 missense probably damaging 1.00
R4647:Slk UTSW 19 47620274 missense possibly damaging 0.71
R4825:Slk UTSW 19 47619956 missense probably benign
R5205:Slk UTSW 19 47625460 missense possibly damaging 0.91
R5228:Slk UTSW 19 47625332 missense probably damaging 1.00
R5372:Slk UTSW 19 47625393 missense probably damaging 1.00
R5665:Slk UTSW 19 47636457 missense probably damaging 1.00
R5688:Slk UTSW 19 47620012 missense probably benign 0.00
R6279:Slk UTSW 19 47642004 missense probably damaging 1.00
R6368:Slk UTSW 19 47620183 missense possibly damaging 0.85
R6431:Slk UTSW 19 47620888 missense probably damaging 1.00
R6563:Slk UTSW 19 47636469 critical splice donor site probably null
R6705:Slk UTSW 19 47609059 missense probably benign 0.01
R6790:Slk UTSW 19 47635568 missense probably damaging 0.96
X0052:Slk UTSW 19 47620933 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTTGGTGTTGATGAGAATCTAACG -3'
(R):5'- TGCTAATGACTCTCACTGGCAG -3'

Sequencing Primer
(F):5'- TCAAGCATTTAAAGTGTGACAGAC -3'
(R):5'- TGACTCTCACTGGCAGATCAAC -3'
Posted On2017-02-10