Incidental Mutation 'R5872:Ptpn14'
ID455219
Institutional Source Beutler Lab
Gene Symbol Ptpn14
Ensembl Gene ENSMUSG00000026604
Gene Nameprotein tyrosine phosphatase, non-receptor type 14
SynonymsC130080N23Rik, PTP36, OTTMUSG00000022087
MMRRC Submission 044079-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5872 (G1)
Quality Score130
Status Not validated
Chromosome1
Chromosomal Location189728268-189876695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 189851032 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 692 (L692P)
Ref Sequence ENSEMBL: ENSMUSP00000095051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027898] [ENSMUST00000097442]
Predicted Effect probably benign
Transcript: ENSMUST00000027898
SMART Domains Protein: ENSMUSP00000027898
Gene: ENSMUSG00000026604

DomainStartEndE-ValueType
B41 17 220 3.7e-67 SMART
FERM_C 224 310 3.43e-15 SMART
low complexity region 565 575 N/A INTRINSIC
low complexity region 633 639 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
PTPc 910 1184 2.14e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097442
AA Change: L692P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095051
Gene: ENSMUSG00000026604
AA Change: L692P

DomainStartEndE-ValueType
B41 17 220 3.7e-67 SMART
FERM_C 224 310 3.43e-15 SMART
low complexity region 565 575 N/A INTRINSIC
low complexity region 633 639 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
PTPc 910 1184 2.14e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195038
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal noncatalytic domain similar to that of band 4.1 superfamily cytoskeleton-associated proteins, which suggested the membrane or cytoskeleton localization of this protein. It appears to regulate lymphatic development in mammals, and a loss of function mutation has been found in a kindred with a lymphedema-choanal atresia. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit some postnatal growth retardation, decreased body weight, periorbital and limb edema, and lymphatic vessel hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,660,352 S1219P possibly damaging Het
A2ml1 A G 6: 128,561,526 Y644H probably damaging Het
Abca9 T G 11: 110,117,076 R1232S possibly damaging Het
Acsf2 C T 11: 94,573,149 V70M probably benign Het
Ampd1 A G 3: 103,079,130 I42V probably benign Het
Arhgap10 A G 8: 77,344,638 probably null Het
Atp1a4 A T 1: 172,244,408 L432Q probably damaging Het
Bbs12 T A 3: 37,320,449 C349S possibly damaging Het
Bnc2 A G 4: 84,292,770 V479A possibly damaging Het
C130060K24Rik A G 6: 65,441,385 probably benign Het
Cald1 A T 6: 34,771,108 K761* probably null Het
Cd177 C T 7: 24,752,263 G443R probably null Het
Cdc42bpb T C 12: 111,325,976 D375G probably damaging Het
Chsy3 T C 18: 59,176,196 Y174H probably damaging Het
Cmya5 T C 13: 93,097,435 M382V probably benign Het
Col1a2 G A 6: 4,531,926 S782N unknown Het
Crtac1 C T 19: 42,309,190 probably null Het
Csmd3 T A 15: 47,582,527 D3683V probably damaging Het
Ctrc A G 4: 141,845,043 L62P probably damaging Het
Cyp3a57 A T 5: 145,371,057 K208* probably null Het
Dnaaf2 A T 12: 69,197,348 L313Q probably damaging Het
Dtl A G 1: 191,546,568 L394P probably benign Het
Ehhadh T C 16: 21,766,555 E192G probably benign Het
Fads2 T C 19: 10,082,633 I226V probably benign Het
Fat2 T C 11: 55,270,382 E3174G probably damaging Het
Galnt14 C T 17: 73,574,831 R91Q probably damaging Het
Hdhd5 G T 6: 120,510,291 D368E probably benign Het
Hk3 T A 13: 55,010,804 I528F probably damaging Het
Hrasls T A 16: 29,220,437 Y90N probably benign Het
Il10ra A C 9: 45,255,653 S533R possibly damaging Het
Itpr3 G T 17: 27,086,976 K169N probably benign Het
Lrrc17 A G 5: 21,575,266 T413A probably benign Het
Mcm2 C T 6: 88,884,071 D882N probably benign Het
Met T C 6: 17,562,198 V1186A probably damaging Het
Msh5 C T 17: 35,029,652 probably null Het
Nav3 T C 10: 109,764,787 I1326M probably damaging Het
Nek10 A G 14: 14,850,896 I314V probably benign Het
Olfr1510 A C 14: 52,410,768 F35V probably damaging Het
Olfr920 T A 9: 38,756,116 Y143N probably benign Het
Pim1 A G 17: 29,493,746 E211G probably damaging Het
Ppp1r12b A T 1: 134,776,406 D903E probably benign Het
Ptprt A G 2: 162,135,218 C387R probably damaging Het
Scarb1 A G 5: 125,304,277 Y68H possibly damaging Het
Shisa6 T A 11: 66,217,974 D359V probably damaging Het
Shprh T C 10: 11,188,073 S1297P probably damaging Het
Sik1 T C 17: 31,850,151 D250G probably damaging Het
Slamf7 A G 1: 171,639,067 L190S probably damaging Het
Slc22a3 G A 17: 12,433,468 P423L probably damaging Het
Slc35e2 A T 4: 155,612,680 E217V probably damaging Het
Spocd1 A T 4: 129,956,461 N760I probably damaging Het
Tas2r136 G T 6: 132,777,331 P278T possibly damaging Het
Tchhl1 A T 3: 93,470,529 Q180L probably benign Het
Tmem151b T A 17: 45,547,084 T79S probably benign Het
Tomm70a T A 16: 57,144,742 C430S probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Trmt1l T G 1: 151,440,843 I32S probably damaging Het
Ubr4 A G 4: 139,425,330 T2011A probably damaging Het
Urb1 C T 16: 90,772,764 W1358* probably null Het
Usp31 T G 7: 121,649,475 H915P probably benign Het
Vmn2r10 A T 5: 109,003,511 M79K possibly damaging Het
Vmn2r14 A G 5: 109,221,356 I117T probably benign Het
Vps13b A G 15: 35,869,351 H2667R possibly damaging Het
Vwa5b1 G A 4: 138,578,651 T912M possibly damaging Het
Zfp709 G A 8: 71,889,519 C264Y probably benign Het
Zkscan5 A G 5: 145,220,088 I467V probably benign Het
Zxdc A T 6: 90,370,299 D214V probably damaging Het
Other mutations in Ptpn14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Ptpn14 APN 1 189822633 missense probably damaging 1.00
IGL02501:Ptpn14 APN 1 189850390 missense probably benign 0.14
IGL03011:Ptpn14 APN 1 189839557 missense probably damaging 1.00
R0724:Ptpn14 UTSW 1 189850947 missense possibly damaging 0.52
R0791:Ptpn14 UTSW 1 189836440 splice site probably benign
R1363:Ptpn14 UTSW 1 189798628 missense probably damaging 1.00
R1605:Ptpn14 UTSW 1 189865512 missense probably benign 0.00
R1840:Ptpn14 UTSW 1 189786851 missense probably damaging 1.00
R1845:Ptpn14 UTSW 1 189839502 missense possibly damaging 0.96
R1891:Ptpn14 UTSW 1 189798653 missense probably damaging 1.00
R2187:Ptpn14 UTSW 1 189863228 nonsense probably null
R2288:Ptpn14 UTSW 1 189865498 missense probably damaging 1.00
R3686:Ptpn14 UTSW 1 189851399 missense probably damaging 1.00
R3895:Ptpn14 UTSW 1 189850546 missense probably benign 0.31
R3898:Ptpn14 UTSW 1 189850531 missense probably benign 0.35
R4004:Ptpn14 UTSW 1 189850510 missense probably benign 0.00
R4816:Ptpn14 UTSW 1 189856800 missense probably damaging 1.00
R4883:Ptpn14 UTSW 1 189850800 missense probably damaging 0.99
R4928:Ptpn14 UTSW 1 189822642 missense probably damaging 1.00
R4931:Ptpn14 UTSW 1 189851277 missense probably benign
R4957:Ptpn14 UTSW 1 189851272 missense probably benign 0.02
R5009:Ptpn14 UTSW 1 189850534 missense probably benign
R5038:Ptpn14 UTSW 1 189786886 missense probably damaging 1.00
R5264:Ptpn14 UTSW 1 189832800 critical splice donor site probably null
R5373:Ptpn14 UTSW 1 189850963 missense probably benign
R5441:Ptpn14 UTSW 1 189798570 missense probably damaging 1.00
R5540:Ptpn14 UTSW 1 189846364 missense probably benign 0.05
R5638:Ptpn14 UTSW 1 189786841 missense probably damaging 1.00
R5746:Ptpn14 UTSW 1 189846413 critical splice donor site probably null
R5988:Ptpn14 UTSW 1 189850387 missense probably damaging 1.00
R6139:Ptpn14 UTSW 1 189851165 missense probably benign 0.01
R6295:Ptpn14 UTSW 1 189850800 missense probably damaging 0.99
R6770:Ptpn14 UTSW 1 189832773 missense probably damaging 1.00
R7097:Ptpn14 UTSW 1 189863398 nonsense probably null
R7320:Ptpn14 UTSW 1 189832759 missense probably benign 0.11
R7324:Ptpn14 UTSW 1 189863424 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ATCAGTCTCTGCAGGAGGTG -3'
(R):5'- CAGTGCCCCATTACTGACAC -3'

Sequencing Primer
(F):5'- AGGTGAGCGAACCCCTTACAG -3'
(R):5'- TCTTGGCCCTGGGTACTCAG -3'
Posted On2017-02-10