Incidental Mutation 'R5872:Cald1'
ID455243
Institutional Source Beutler Lab
Gene Symbol Cald1
Ensembl Gene ENSMUSG00000029761
Gene Namecaldesmon 1
Synonyms4833423D12Rik, C920027I18Rik
MMRRC Submission 044079-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5872 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location34598500-34775473 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 34771108 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 761 (K761*)
Ref Sequence ENSEMBL: ENSMUSP00000110679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031775] [ENSMUST00000079391] [ENSMUST00000115021] [ENSMUST00000115026] [ENSMUST00000115027] [ENSMUST00000149009]
Predicted Effect probably null
Transcript: ENSMUST00000031775
AA Change: K547*
SMART Domains Protein: ENSMUSP00000031775
Gene: ENSMUSG00000029761
AA Change: K547*

DomainStartEndE-ValueType
Pfam:Caldesmon 25 542 5.7e-256 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000079391
AA Change: K527*
SMART Domains Protein: ENSMUSP00000078362
Gene: ENSMUSG00000029761
AA Change: K527*

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Caldesmon 31 522 4.3e-260 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115021
AA Change: K523*
SMART Domains Protein: ENSMUSP00000110673
Gene: ENSMUSG00000029761
AA Change: K523*

DomainStartEndE-ValueType
Pfam:Caldesmon 25 518 7.5e-259 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115026
AA Change: K529*
SMART Domains Protein: ENSMUSP00000110678
Gene: ENSMUSG00000029761
AA Change: K529*

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Caldesmon 31 524 4.9e-259 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115027
AA Change: K761*
SMART Domains Protein: ENSMUSP00000110679
Gene: ENSMUSG00000029761
AA Change: K761*

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Caldesmon 31 363 8.4e-34 PFAM
Pfam:Caldesmon 243 755 3.8e-144 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132331
Predicted Effect probably benign
Transcript: ENSMUST00000149009
SMART Domains Protein: ENSMUSP00000138368
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 25 507 2e-247 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201956
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Some homozygous mutant mice develop hernia and those that do, die within 5-7 hours after birth. Mice homozygous for a different targeted allele fail to develop. Mice heterozygous for this allele exhibit increased urinary bladder weight, smooth muscle bundles and non-voiding contractions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,660,352 S1219P possibly damaging Het
A2ml1 A G 6: 128,561,526 Y644H probably damaging Het
Abca9 T G 11: 110,117,076 R1232S possibly damaging Het
Acsf2 C T 11: 94,573,149 V70M probably benign Het
Ampd1 A G 3: 103,079,130 I42V probably benign Het
Arhgap10 A G 8: 77,344,638 probably null Het
Atp1a4 A T 1: 172,244,408 L432Q probably damaging Het
Bbs12 T A 3: 37,320,449 C349S possibly damaging Het
Bnc2 A G 4: 84,292,770 V479A possibly damaging Het
C130060K24Rik A G 6: 65,441,385 probably benign Het
Cd177 C T 7: 24,752,263 G443R probably null Het
Cdc42bpb T C 12: 111,325,976 D375G probably damaging Het
Chsy3 T C 18: 59,176,196 Y174H probably damaging Het
Cmya5 T C 13: 93,097,435 M382V probably benign Het
Col1a2 G A 6: 4,531,926 S782N unknown Het
Crtac1 C T 19: 42,309,190 probably null Het
Csmd3 T A 15: 47,582,527 D3683V probably damaging Het
Ctrc A G 4: 141,845,043 L62P probably damaging Het
Cyp3a57 A T 5: 145,371,057 K208* probably null Het
Dnaaf2 A T 12: 69,197,348 L313Q probably damaging Het
Dtl A G 1: 191,546,568 L394P probably benign Het
Ehhadh T C 16: 21,766,555 E192G probably benign Het
Fads2 T C 19: 10,082,633 I226V probably benign Het
Fat2 T C 11: 55,270,382 E3174G probably damaging Het
Galnt14 C T 17: 73,574,831 R91Q probably damaging Het
Hdhd5 G T 6: 120,510,291 D368E probably benign Het
Hk3 T A 13: 55,010,804 I528F probably damaging Het
Hrasls T A 16: 29,220,437 Y90N probably benign Het
Il10ra A C 9: 45,255,653 S533R possibly damaging Het
Itpr3 G T 17: 27,086,976 K169N probably benign Het
Lrrc17 A G 5: 21,575,266 T413A probably benign Het
Mcm2 C T 6: 88,884,071 D882N probably benign Het
Met T C 6: 17,562,198 V1186A probably damaging Het
Msh5 C T 17: 35,029,652 probably null Het
Nav3 T C 10: 109,764,787 I1326M probably damaging Het
Nek10 A G 14: 14,850,896 I314V probably benign Het
Olfr1510 A C 14: 52,410,768 F35V probably damaging Het
Olfr920 T A 9: 38,756,116 Y143N probably benign Het
Pim1 A G 17: 29,493,746 E211G probably damaging Het
Ppp1r12b A T 1: 134,776,406 D903E probably benign Het
Ptpn14 T C 1: 189,851,032 L692P probably benign Het
Ptprt A G 2: 162,135,218 C387R probably damaging Het
Scarb1 A G 5: 125,304,277 Y68H possibly damaging Het
Shisa6 T A 11: 66,217,974 D359V probably damaging Het
Shprh T C 10: 11,188,073 S1297P probably damaging Het
Sik1 T C 17: 31,850,151 D250G probably damaging Het
Slamf7 A G 1: 171,639,067 L190S probably damaging Het
Slc22a3 G A 17: 12,433,468 P423L probably damaging Het
Slc35e2 A T 4: 155,612,680 E217V probably damaging Het
Spocd1 A T 4: 129,956,461 N760I probably damaging Het
Tas2r136 G T 6: 132,777,331 P278T possibly damaging Het
Tchhl1 A T 3: 93,470,529 Q180L probably benign Het
Tmem151b T A 17: 45,547,084 T79S probably benign Het
Tomm70a T A 16: 57,144,742 C430S probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Trmt1l T G 1: 151,440,843 I32S probably damaging Het
Ubr4 A G 4: 139,425,330 T2011A probably damaging Het
Urb1 C T 16: 90,772,764 W1358* probably null Het
Usp31 T G 7: 121,649,475 H915P probably benign Het
Vmn2r10 A T 5: 109,003,511 M79K possibly damaging Het
Vmn2r14 A G 5: 109,221,356 I117T probably benign Het
Vps13b A G 15: 35,869,351 H2667R possibly damaging Het
Vwa5b1 G A 4: 138,578,651 T912M possibly damaging Het
Zfp709 G A 8: 71,889,519 C264Y probably benign Het
Zkscan5 A G 5: 145,220,088 I467V probably benign Het
Zxdc A T 6: 90,370,299 D214V probably damaging Het
Other mutations in Cald1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Cald1 APN 6 34762261 missense possibly damaging 0.66
IGL01456:Cald1 APN 6 34764996 missense probably damaging 1.00
IGL01822:Cald1 APN 6 34753572 missense probably damaging 0.99
IGL01959:Cald1 APN 6 34753468 missense probably damaging 1.00
IGL02307:Cald1 APN 6 34753455 missense probably damaging 1.00
IGL03122:Cald1 APN 6 34765028 missense probably damaging 1.00
R0060:Cald1 UTSW 6 34715459 intron probably benign
R0071:Cald1 UTSW 6 34758134 splice site probably benign
R0071:Cald1 UTSW 6 34758134 splice site probably benign
R0701:Cald1 UTSW 6 34746173 frame shift probably null
R0776:Cald1 UTSW 6 34746173 frame shift probably null
R1053:Cald1 UTSW 6 34755642 missense probably damaging 1.00
R1696:Cald1 UTSW 6 34745711 missense probably damaging 1.00
R2025:Cald1 UTSW 6 34746173 frame shift probably null
R2157:Cald1 UTSW 6 34686041 missense possibly damaging 0.86
R2973:Cald1 UTSW 6 34757996 unclassified probably benign
R3839:Cald1 UTSW 6 34745765 missense probably damaging 1.00
R4116:Cald1 UTSW 6 34745719 missense probably damaging 1.00
R4674:Cald1 UTSW 6 34746173 frame shift probably null
R5140:Cald1 UTSW 6 34753580 missense probably damaging 1.00
R5254:Cald1 UTSW 6 34746416 intron probably benign
R5620:Cald1 UTSW 6 34762112 missense probably damaging 1.00
R5648:Cald1 UTSW 6 34762332 splice site probably null
R5651:Cald1 UTSW 6 34762320 missense probably damaging 0.98
R5783:Cald1 UTSW 6 34753533 missense possibly damaging 0.51
R5999:Cald1 UTSW 6 34746338 intron probably benign
R6218:Cald1 UTSW 6 34747928 frame shift probably null
R6347:Cald1 UTSW 6 34765046 missense probably damaging 1.00
R6598:Cald1 UTSW 6 34746640 critical splice donor site probably null
R7120:Cald1 UTSW 6 34686076 critical splice donor site probably null
R7147:Cald1 UTSW 6 34746296 missense
R7385:Cald1 UTSW 6 34686065 missense probably damaging 0.99
X0064:Cald1 UTSW 6 34746205 intron probably benign
Predicted Primers PCR Primer
(F):5'- GGTCAAGGTCTGTTCACAGTC -3'
(R):5'- AACCTGCAGTGTCAATGGC -3'

Sequencing Primer
(F):5'- GGAACCAACTAGTGCTTCTTCC -3'
(R):5'- CAGTGTCAATGGCTTTGTAAATTGTC -3'
Posted On2017-02-10