Incidental Mutation 'R5872:Dnaaf2'
ID455265
Institutional Source Beutler Lab
Gene Symbol Dnaaf2
Ensembl Gene ENSMUSG00000020973
Gene Namedynein, axonemal assembly factor 2
Synonyms2810020C19Rik, kintoun, Ktu, 1110034A24Rik
MMRRC Submission 044079-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5872 (G1)
Quality Score128
Status Not validated
Chromosome12
Chromosomal Location69189087-69198429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69197348 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 313 (L313Q)
Ref Sequence ENSEMBL: ENSMUSP00000021356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021356] [ENSMUST00000021359] [ENSMUST00000221411] [ENSMUST00000222699]
Predicted Effect probably damaging
Transcript: ENSMUST00000021356
AA Change: L313Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021356
Gene: ENSMUSG00000020973
AA Change: L313Q

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:PIH1 43 352 2e-99 PFAM
low complexity region 360 373 N/A INTRINSIC
SCOP:d1keka4 398 460 4e-3 SMART
low complexity region 672 693 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021359
SMART Domains Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974

DomainStartEndE-ValueType
Pfam:Dpoe2NT 2 74 1.9e-32 PFAM
Pfam:DNA_pol_E_B 287 489 1.4e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181850
SMART Domains Protein: ENSMUSP00000137753
Gene: ENSMUSG00000097061

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221986
Predicted Effect probably benign
Transcript: ENSMUST00000222699
Predicted Effect probably benign
Transcript: ENSMUST00000223192
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a highly conserved protein involved in the preassembly of dynein arm complexes which power cilia. These complexes are found in some cilia and are assembled in the cytoplasm prior to transport for cilia formation. Mutations in the human gene have been associated with primary ciliary dyskinesia. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, reduced body size, situs inversus totalis, hydroencephaly and abnormal brain ependymal and tracheal cilia morphology and motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,660,352 S1219P possibly damaging Het
A2ml1 A G 6: 128,561,526 Y644H probably damaging Het
Abca9 T G 11: 110,117,076 R1232S possibly damaging Het
Acsf2 C T 11: 94,573,149 V70M probably benign Het
Ampd1 A G 3: 103,079,130 I42V probably benign Het
Arhgap10 A G 8: 77,344,638 probably null Het
Atp1a4 A T 1: 172,244,408 L432Q probably damaging Het
Bbs12 T A 3: 37,320,449 C349S possibly damaging Het
Bnc2 A G 4: 84,292,770 V479A possibly damaging Het
C130060K24Rik A G 6: 65,441,385 probably benign Het
Cald1 A T 6: 34,771,108 K761* probably null Het
Cd177 C T 7: 24,752,263 G443R probably null Het
Cdc42bpb T C 12: 111,325,976 D375G probably damaging Het
Chsy3 T C 18: 59,176,196 Y174H probably damaging Het
Cmya5 T C 13: 93,097,435 M382V probably benign Het
Col1a2 G A 6: 4,531,926 S782N unknown Het
Crtac1 C T 19: 42,309,190 probably null Het
Csmd3 T A 15: 47,582,527 D3683V probably damaging Het
Ctrc A G 4: 141,845,043 L62P probably damaging Het
Cyp3a57 A T 5: 145,371,057 K208* probably null Het
Dtl A G 1: 191,546,568 L394P probably benign Het
Ehhadh T C 16: 21,766,555 E192G probably benign Het
Fads2 T C 19: 10,082,633 I226V probably benign Het
Fat2 T C 11: 55,270,382 E3174G probably damaging Het
Galnt14 C T 17: 73,574,831 R91Q probably damaging Het
Hdhd5 G T 6: 120,510,291 D368E probably benign Het
Hk3 T A 13: 55,010,804 I528F probably damaging Het
Hrasls T A 16: 29,220,437 Y90N probably benign Het
Il10ra A C 9: 45,255,653 S533R possibly damaging Het
Itpr3 G T 17: 27,086,976 K169N probably benign Het
Lrrc17 A G 5: 21,575,266 T413A probably benign Het
Mcm2 C T 6: 88,884,071 D882N probably benign Het
Met T C 6: 17,562,198 V1186A probably damaging Het
Msh5 C T 17: 35,029,652 probably null Het
Nav3 T C 10: 109,764,787 I1326M probably damaging Het
Nek10 A G 14: 14,850,896 I314V probably benign Het
Olfr1510 A C 14: 52,410,768 F35V probably damaging Het
Olfr920 T A 9: 38,756,116 Y143N probably benign Het
Pim1 A G 17: 29,493,746 E211G probably damaging Het
Ppp1r12b A T 1: 134,776,406 D903E probably benign Het
Ptpn14 T C 1: 189,851,032 L692P probably benign Het
Ptprt A G 2: 162,135,218 C387R probably damaging Het
Scarb1 A G 5: 125,304,277 Y68H possibly damaging Het
Shisa6 T A 11: 66,217,974 D359V probably damaging Het
Shprh T C 10: 11,188,073 S1297P probably damaging Het
Sik1 T C 17: 31,850,151 D250G probably damaging Het
Slamf7 A G 1: 171,639,067 L190S probably damaging Het
Slc22a3 G A 17: 12,433,468 P423L probably damaging Het
Slc35e2 A T 4: 155,612,680 E217V probably damaging Het
Spocd1 A T 4: 129,956,461 N760I probably damaging Het
Tas2r136 G T 6: 132,777,331 P278T possibly damaging Het
Tchhl1 A T 3: 93,470,529 Q180L probably benign Het
Tmem151b T A 17: 45,547,084 T79S probably benign Het
Tomm70a T A 16: 57,144,742 C430S probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Trmt1l T G 1: 151,440,843 I32S probably damaging Het
Ubr4 A G 4: 139,425,330 T2011A probably damaging Het
Urb1 C T 16: 90,772,764 W1358* probably null Het
Usp31 T G 7: 121,649,475 H915P probably benign Het
Vmn2r10 A T 5: 109,003,511 M79K possibly damaging Het
Vmn2r14 A G 5: 109,221,356 I117T probably benign Het
Vps13b A G 15: 35,869,351 H2667R possibly damaging Het
Vwa5b1 G A 4: 138,578,651 T912M possibly damaging Het
Zfp709 G A 8: 71,889,519 C264Y probably benign Het
Zkscan5 A G 5: 145,220,088 I467V probably benign Het
Zxdc A T 6: 90,370,299 D214V probably damaging Het
Other mutations in Dnaaf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Dnaaf2 APN 12 69196766 missense probably benign 0.23
IGL01321:Dnaaf2 APN 12 69196602 missense probably damaging 1.00
IGL01880:Dnaaf2 APN 12 69190037 missense probably benign 0.17
R0329:Dnaaf2 UTSW 12 69197744 missense probably damaging 1.00
R0330:Dnaaf2 UTSW 12 69197744 missense probably damaging 1.00
R1051:Dnaaf2 UTSW 12 69197795 missense probably damaging 1.00
R1668:Dnaaf2 UTSW 12 69196691 missense probably benign 0.04
R2011:Dnaaf2 UTSW 12 69196785 missense probably damaging 1.00
R2179:Dnaaf2 UTSW 12 69198297 unclassified probably benign
R2243:Dnaaf2 UTSW 12 69196644 missense possibly damaging 0.83
R2356:Dnaaf2 UTSW 12 69198218 missense probably benign 0.01
R4120:Dnaaf2 UTSW 12 69198038 missense possibly damaging 0.85
R5086:Dnaaf2 UTSW 12 69197286 missense probably damaging 1.00
R5205:Dnaaf2 UTSW 12 69192924 missense probably damaging 1.00
R5300:Dnaaf2 UTSW 12 69198228 missense probably damaging 0.99
R5399:Dnaaf2 UTSW 12 69196742 missense probably damaging 0.97
R5739:Dnaaf2 UTSW 12 69196941 missense probably benign
R5765:Dnaaf2 UTSW 12 69192853 missense probably damaging 1.00
R6043:Dnaaf2 UTSW 12 69197348 missense probably damaging 1.00
R6338:Dnaaf2 UTSW 12 69198122 missense probably damaging 1.00
R6503:Dnaaf2 UTSW 12 69197511 missense probably benign 0.42
R6524:Dnaaf2 UTSW 12 69190385 missense probably benign 0.43
R6895:Dnaaf2 UTSW 12 69197663 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTTCCCGAGGTCTAGAGGTG -3'
(R):5'- TCAAGTACAAGGGGATGCCC -3'

Sequencing Primer
(F):5'- TCTAGAGGTGCCACCGAGTC -3'
(R):5'- GGCTTTTCCCGGACCCAC -3'
Posted On2017-02-10