Incidental Mutation 'R5873:Asxl3'
ID455350
Institutional Source Beutler Lab
Gene Symbol Asxl3
Ensembl Gene ENSMUSG00000045215
Gene Nameadditional sex combs like 3, transcriptional regulator
SynonymsD930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik
MMRRC Submission 044080-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.859) question?
Stock #R5873 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location22344883-22530227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22516085 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 377 (D377G)
Ref Sequence ENSEMBL: ENSMUSP00000112793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]
Predicted Effect probably benign
Transcript: ENSMUST00000097655
AA Change: D377G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: D377G

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 173 305 5.6e-50 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2139 2202 9.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120223
AA Change: D377G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: D377G

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 179 304 1.3e-36 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2138 2202 1.9e-24 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,630,167 probably null Het
4930505A04Rik T A 11: 30,426,220 K216* probably null Het
5330417H12Rik T C 7: 107,624,768 probably benign Het
Abcc4 G T 14: 118,526,290 D1044E probably benign Het
Adgre4 A G 17: 55,852,282 T656A probably benign Het
Ankk1 T C 9: 49,415,896 N661S probably benign Het
Asah2 A G 19: 32,003,682 probably null Het
C3ar1 A G 6: 122,850,422 S279P probably benign Het
C7 A G 15: 5,005,235 V610A probably damaging Het
Cacna2d3 C A 14: 29,720,934 A48S probably benign Het
Card11 T A 5: 140,908,638 I79F probably damaging Het
Casc3 A G 11: 98,821,444 Y103C unknown Het
Cass4 G T 2: 172,426,768 V259L probably benign Het
Col14a1 A G 15: 55,445,786 probably benign Het
Cox10 A G 11: 64,071,686 S110P probably benign Het
Cpt1b T C 15: 89,420,728 Y439C probably damaging Het
Crybb2 C T 5: 113,065,893 probably null Het
Cyp2b23 C T 7: 26,675,006 R271H probably benign Het
Dnah17 T C 11: 118,056,897 I3039V probably benign Het
Dnpep T C 1: 75,315,143 D242G probably damaging Het
Dock10 T A 1: 80,574,138 N660I probably damaging Het
Esco2 T C 14: 65,824,191 D471G probably benign Het
Evpl A T 11: 116,234,432 L97H probably damaging Het
Exoc3l4 A T 12: 111,423,416 I142F probably damaging Het
Fry C A 5: 150,378,885 P519Q probably damaging Het
Gal3st2 T A 1: 93,873,750 F92I probably benign Het
Galm A G 17: 80,138,103 E94G probably benign Het
Gfy T G 7: 45,177,580 H364P probably damaging Het
Helz2 A G 2: 181,234,028 S1558P possibly damaging Het
Hmmr T A 11: 40,707,700 Q600L probably damaging Het
Hnrnph3 A G 10: 63,019,391 probably null Het
Igkv4-90 T A 6: 68,807,469 N21I probably benign Het
Kpna1 A G 16: 36,014,228 probably benign Het
Krt28 A C 11: 99,366,890 L375R probably damaging Het
Lrrn1 T C 6: 107,568,975 V578A probably damaging Het
Lta4h T C 10: 93,469,190 probably null Het
Matk T A 10: 81,260,129 V166E probably benign Het
Muc4 C A 16: 32,751,295 T391K possibly damaging Het
Mybl1 T A 1: 9,685,665 T220S possibly damaging Het
Nrp1 T C 8: 128,468,377 V438A probably damaging Het
Olfr1371 A T 11: 52,213,353 L212Q probably damaging Het
Olfr414 T A 1: 174,430,782 M118K possibly damaging Het
Pdia4 A T 6: 47,808,176 W86R probably damaging Het
Pdzd7 T A 19: 45,027,949 D911V probably damaging Het
Pkd1 A G 17: 24,569,830 Q854R probably benign Het
Ppl A G 16: 5,106,049 probably null Het
Ppp1r26 A G 2: 28,451,605 T416A probably benign Het
Prdm15 T C 16: 97,808,689 D585G probably damaging Het
Rbak A G 5: 143,173,711 V529A probably benign Het
Rc3h1 C T 1: 160,959,501 T822I probably damaging Het
Slc25a18 A T 6: 120,786,281 probably null Het
Taf2 T C 15: 55,038,422 N792S probably benign Het
Tat T C 8: 109,991,949 probably null Het
Tbx21 A T 11: 97,114,648 probably null Het
Txndc11 A G 16: 11,075,205 L887P probably damaging Het
Usp10 A G 8: 119,947,092 T399A possibly damaging Het
Vmn2r26 A T 6: 124,061,674 H736L probably benign Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zkscan5 A G 5: 145,220,394 R496G possibly damaging Het
Zranb2 C T 3: 157,536,383 R36* probably null Het
Other mutations in Asxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Asxl3 APN 18 22525223 missense probably benign 0.41
IGL00510:Asxl3 APN 18 22523565 missense probably damaging 1.00
IGL00864:Asxl3 APN 18 22522446 missense probably benign 0.06
IGL01074:Asxl3 APN 18 22522845 missense probably damaging 1.00
IGL01305:Asxl3 APN 18 22516446 missense probably benign 0.06
IGL01313:Asxl3 APN 18 22517459 missense probably benign 0.41
IGL01349:Asxl3 APN 18 22524237 missense probably benign 0.28
IGL01529:Asxl3 APN 18 22517655 missense probably damaging 1.00
IGL01574:Asxl3 APN 18 22523564 missense probably benign 0.06
IGL01583:Asxl3 APN 18 22516597 missense probably benign 0.01
IGL01619:Asxl3 APN 18 22523328 missense probably damaging 1.00
IGL01720:Asxl3 APN 18 22525325 missense probably damaging 1.00
IGL01816:Asxl3 APN 18 22522488 missense probably benign 0.10
IGL01828:Asxl3 APN 18 22525558 utr 3 prime probably benign
IGL01903:Asxl3 APN 18 22434576 missense probably benign 0.00
IGL01906:Asxl3 APN 18 22522281 missense probably benign 0.01
IGL01962:Asxl3 APN 18 22522445 missense probably benign 0.00
IGL01991:Asxl3 APN 18 22516162 missense probably damaging 1.00
IGL02064:Asxl3 APN 18 22524344 missense possibly damaging 0.59
IGL02187:Asxl3 APN 18 22524978 missense probably damaging 0.99
IGL02219:Asxl3 APN 18 22453626 missense possibly damaging 0.81
IGL02309:Asxl3 APN 18 22522453 missense probably benign 0.01
IGL02478:Asxl3 APN 18 22523013 missense possibly damaging 0.77
IGL02506:Asxl3 APN 18 22452399 missense probably benign 0.19
IGL02660:Asxl3 APN 18 22524345 missense probably damaging 0.98
IGL02828:Asxl3 APN 18 22524661 missense possibly damaging 0.87
IGL02863:Asxl3 APN 18 22523484 missense probably benign 0.01
IGL03001:Asxl3 APN 18 22517398 missense probably damaging 1.00
IGL03143:Asxl3 APN 18 22522974 missense probably benign 0.43
ANU22:Asxl3 UTSW 18 22516446 missense probably benign 0.06
R0145:Asxl3 UTSW 18 22453605 missense probably damaging 1.00
R0201:Asxl3 UTSW 18 22523154 missense probably benign
R0207:Asxl3 UTSW 18 22411496 splice site probably benign
R0230:Asxl3 UTSW 18 22452326 splice site probably benign
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0344:Asxl3 UTSW 18 22517611 missense probably benign 0.00
R0519:Asxl3 UTSW 18 22523520 missense possibly damaging 0.85
R0520:Asxl3 UTSW 18 22522986 missense probably damaging 0.96
R0548:Asxl3 UTSW 18 22521792 splice site probably benign
R0626:Asxl3 UTSW 18 22522880 missense probably benign 0.02
R0711:Asxl3 UTSW 18 22524451 missense probably benign 0.01
R0744:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R0833:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R1035:Asxl3 UTSW 18 22525049 missense probably damaging 1.00
R1170:Asxl3 UTSW 18 22524507 missense probably benign 0.00
R1372:Asxl3 UTSW 18 22410009 missense probably benign 0.00
R1440:Asxl3 UTSW 18 22525224 missense probably benign 0.13
R1463:Asxl3 UTSW 18 22516753 missense possibly damaging 0.94
R1471:Asxl3 UTSW 18 22516354 missense probably damaging 1.00
R1618:Asxl3 UTSW 18 22516987 missense probably damaging 1.00
R1720:Asxl3 UTSW 18 22452435 missense probably damaging 1.00
R1819:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R1824:Asxl3 UTSW 18 22522068 missense probably damaging 1.00
R1851:Asxl3 UTSW 18 22517739 missense probably damaging 0.97
R1989:Asxl3 UTSW 18 22452363 missense probably damaging 1.00
R2041:Asxl3 UTSW 18 22523451 missense probably benign 0.02
R2174:Asxl3 UTSW 18 22453644 missense possibly damaging 0.76
R2175:Asxl3 UTSW 18 22516595 missense probably benign
R2443:Asxl3 UTSW 18 22411539 missense probably benign 0.12
R2907:Asxl3 UTSW 18 22517273 missense possibly damaging 0.56
R4246:Asxl3 UTSW 18 22525500 missense probably damaging 1.00
R4254:Asxl3 UTSW 18 22524366 missense possibly damaging 0.58
R4441:Asxl3 UTSW 18 22524233 missense probably damaging 0.97
R4660:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4661:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4674:Asxl3 UTSW 18 22517738 missense probably damaging 1.00
R4749:Asxl3 UTSW 18 22516769 missense probably damaging 0.99
R4817:Asxl3 UTSW 18 22525454 missense probably damaging 0.97
R4935:Asxl3 UTSW 18 22523312 missense probably benign 0.06
R5062:Asxl3 UTSW 18 22522718 missense possibly damaging 0.92
R5064:Asxl3 UTSW 18 22516019 missense probably benign 0.00
R5065:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5066:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5067:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5133:Asxl3 UTSW 18 22516708 missense probably damaging 1.00
R5174:Asxl3 UTSW 18 22523115 missense probably benign 0.45
R5183:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5294:Asxl3 UTSW 18 22516439 missense possibly damaging 0.77
R5416:Asxl3 UTSW 18 22524494 missense probably damaging 1.00
R5587:Asxl3 UTSW 18 22525247 missense probably benign 0.28
R6240:Asxl3 UTSW 18 22465508 missense probably damaging 1.00
R6242:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R6316:Asxl3 UTSW 18 22522782 missense probably damaging 1.00
R6348:Asxl3 UTSW 18 22517273 missense possibly damaging 0.56
R6518:Asxl3 UTSW 18 22516340 missense probably damaging 0.96
R6605:Asxl3 UTSW 18 22517077 nonsense probably null
R6704:Asxl3 UTSW 18 22517305 missense probably benign 0.00
R6706:Asxl3 UTSW 18 22453609 missense probably damaging 1.00
R6786:Asxl3 UTSW 18 22525440 missense probably damaging 1.00
R6799:Asxl3 UTSW 18 22465400 nonsense probably null
R6811:Asxl3 UTSW 18 22522911 missense possibly damaging 0.87
R6817:Asxl3 UTSW 18 22523580 missense probably benign 0.00
R6830:Asxl3 UTSW 18 22525388 missense probably benign 0.45
R6957:Asxl3 UTSW 18 22522091 missense probably damaging 1.00
R7015:Asxl3 UTSW 18 22523921 missense probably benign 0.00
R7058:Asxl3 UTSW 18 22517674 missense probably damaging 1.00
R7135:Asxl3 UTSW 18 22517701 nonsense probably null
R7135:Asxl3 UTSW 18 22517702 missense probably damaging 1.00
R7231:Asxl3 UTSW 18 22411499 critical splice acceptor site probably null
R7231:Asxl3 UTSW 18 22517540 missense probably damaging 1.00
Z1088:Asxl3 UTSW 18 22516772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCGGGCATGTCCAGAGAAG -3'
(R):5'- TATCTTCAGGGGCTGCTACCTG -3'

Sequencing Primer
(F):5'- TTACTTCTGGACCAAACCATGAAGG -3'
(R):5'- TACCTGGGGTTCCTCACAAG -3'
Posted On2017-02-10