Incidental Mutation 'R5874:Dnah7b'
ID455354
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Namedynein, axonemal, heavy chain 7B
SynonymsDnahc7b, LOC227058
MMRRC Submission 044081-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R5874 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location46066315-46373546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46191725 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1381 (T1381I)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
Predicted Effect probably damaging
Transcript: ENSMUST00000069293
AA Change: T1381I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: T1381I

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Meta Mutation Damage Score 0.402 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 98% (86/88)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik A T 9: 51,290,372 L128* probably null Het
2410131K14Rik T C 5: 118,259,439 V162A probably damaging Het
4930432E11Rik G A 7: 29,581,185 noncoding transcript Het
Adam17 T C 12: 21,329,086 D654G possibly damaging Het
Ankhd1 A T 18: 36,640,269 H1373L possibly damaging Het
Ankrd17 T C 5: 90,268,797 probably benign Het
Calu A G 6: 29,372,618 D112G probably damaging Het
Camk2a G C 18: 60,943,200 probably benign Het
Ccdc130 T A 8: 84,258,548 D364V possibly damaging Het
Cpn1 C A 19: 43,956,512 R452L probably benign Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cuedc2 C T 19: 46,331,385 V164M possibly damaging Het
Cyp2d34 T A 15: 82,619,042 D74V probably benign Het
Ddi2 A G 4: 141,695,469 S311P probably damaging Het
Ddx10 A C 9: 53,229,198 I301R possibly damaging Het
Dmpk T C 7: 19,092,082 probably benign Het
Dst T A 1: 34,179,589 N1703K probably damaging Het
Dtwd1 T A 2: 126,158,439 H98Q probably damaging Het
Ecel1 A C 1: 87,148,009 V769G probably benign Het
Eno4 T C 19: 58,946,806 V150A probably benign Het
Evc2 C T 5: 37,417,539 probably benign Het
Ext1 T A 15: 53,101,752 Q406L possibly damaging Het
Fam104a T A 11: 113,677,394 R78S probably damaging Het
Fam35a T C 14: 34,245,258 T114A probably benign Het
Foxf2 A G 13: 31,626,792 H238R probably benign Het
Frem2 C G 3: 53,537,489 G2407A probably benign Het
Fzd10 A G 5: 128,601,300 E28G probably benign Het
Galnt15 T C 14: 32,052,367 F363L probably damaging Het
Gm1758 C T 16: 14,507,173 noncoding transcript Het
Gm5866 C T 5: 52,582,614 noncoding transcript Het
Gm6614 A T 6: 141,972,235 H638Q probably benign Het
Heatr9 T A 11: 83,514,600 M345L probably benign Het
Il23r A T 6: 67,431,645 F404Y possibly damaging Het
Lrrc8a T C 2: 30,257,136 I654T probably damaging Het
Napg A T 18: 62,978,020 K18* probably null Het
Ndst3 A T 3: 123,561,907 W573R probably damaging Het
Nin T C 12: 70,030,918 S1038G possibly damaging Het
Nudt12 T A 17: 59,010,284 R123* probably null Het
Oas1g T A 5: 120,877,018 N361Y probably benign Het
Olfr1100 A T 2: 86,978,442 M118K probably damaging Het
Olfr1351 T A 10: 79,017,357 F12I possibly damaging Het
Olfr470 T A 7: 107,845,170 I188L probably benign Het
Osbpl10 T C 9: 115,226,760 F667L probably damaging Het
Phldb2 T C 16: 45,801,625 D664G probably damaging Het
Piezo2 C T 18: 63,027,901 V2263M probably damaging Het
Pkd1l1 A G 11: 8,908,688 L615P probably damaging Het
Pnpla7 G A 2: 25,011,649 M562I probably benign Het
Ppp1r13b C A 12: 111,844,989 R155L probably damaging Het
Pygb C T 2: 150,786,878 P4L probably benign Het
Rbm44 T C 1: 91,156,840 probably null Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Rin3 A G 12: 102,389,843 Y801C probably damaging Het
Rnf112 A G 11: 61,449,447 V619A probably damaging Het
Rnf182 A G 13: 43,668,087 E38G probably benign Het
Scgb2b24 T A 7: 33,737,405 Y94F probably damaging Het
Serac1 C A 17: 6,043,913 probably benign Het
Slc6a19 A T 13: 73,684,368 V402D probably damaging Het
Slco2b1 T A 7: 99,667,094 M410L probably benign Het
Smarca2 T C 19: 26,776,069 probably benign Het
Sned1 A G 1: 93,265,345 Y409C probably damaging Het
Sorcs2 A G 5: 36,229,211 V161A probably damaging Het
Sptb T C 12: 76,598,727 E2029G possibly damaging Het
Stx7 T A 10: 24,182,761 probably null Het
Taf4b T C 18: 14,804,554 V228A probably benign Het
Tbc1d1 A G 5: 64,349,930 *1163W probably null Het
Tor4a G A 2: 25,194,835 A352V probably damaging Het
Trpm4 A G 7: 45,327,749 F81S probably damaging Het
Ttn T A 2: 76,950,092 D1105V probably damaging Het
Zfp551 A G 7: 12,416,174 L436P probably damaging Het
Zfp975 G T 7: 42,662,888 D100E probably benign Het
Zswim3 A G 2: 164,820,112 I171V probably benign Het
Zwint C T 10: 72,656,462 probably benign Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46142149 missense probably benign 0.04
IGL00796:Dnah7b APN 1 46211337 missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46224651 missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46066729 unclassified probably benign
IGL00950:Dnah7b APN 1 46214322 missense probably benign 0.07
IGL01142:Dnah7b APN 1 46195378 critical splice donor site probably null
IGL01350:Dnah7b APN 1 46081432 splice site probably benign
IGL01392:Dnah7b APN 1 46126788 missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46116300 splice site probably benign
IGL01460:Dnah7b APN 1 46139704 missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46268653 missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46358147 missense probably benign 0.29
IGL01838:Dnah7b APN 1 46358137 nonsense probably null
IGL01906:Dnah7b APN 1 46175453 missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46124337 splice site probably benign
IGL01989:Dnah7b APN 1 46289534 missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46139875 missense probably benign
IGL02213:Dnah7b APN 1 46233592 missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46226930 missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46099503 nonsense probably null
IGL02381:Dnah7b APN 1 46277120 missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46234193 missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46195318 missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46123777 missense probably benign 0.02
IGL02655:Dnah7b APN 1 46116301 splice site probably benign
IGL02704:Dnah7b APN 1 46142133 missense probably benign 0.03
IGL02719:Dnah7b APN 1 46099608 splice site probably benign
IGL02745:Dnah7b APN 1 46195029 splice site probably benign
IGL02818:Dnah7b APN 1 46290808 missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46119298 missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46182375 missense probably benign 0.00
IGL03354:Dnah7b APN 1 46085689 missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46119304 missense probably benign 0.18
R0116:Dnah7b UTSW 1 46213360 missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46223178 missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46219348 missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46123777 missense probably benign 0.26
R0313:Dnah7b UTSW 1 46207643 missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46134656 missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46240944 missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46277126 missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46236788 missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46140176 missense probably benign 0.00
R0502:Dnah7b UTSW 1 46219544 missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46240992 missense probably benign 0.02
R0664:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46340132 missense probably benign 0.00
R0931:Dnah7b UTSW 1 46099612 splice site probably benign
R1035:Dnah7b UTSW 1 46124448 missense probably benign
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46325810 missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46340120 missense probably benign 0.00
R1318:Dnah7b UTSW 1 46099509 missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46289656 missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46078593 splice site probably benign
R1484:Dnah7b UTSW 1 46137543 missense probably benign 0.00
R1529:Dnah7b UTSW 1 46177281 missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46066797 missense unknown
R1607:Dnah7b UTSW 1 46290646 missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46352966 missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46175390 nonsense probably null
R1681:Dnah7b UTSW 1 46324712 nonsense probably null
R1716:Dnah7b UTSW 1 46191783 missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46233759 missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46116177 missense probably benign 0.04
R1838:Dnah7b UTSW 1 46277105 missense probably damaging 1.00
R1898:Dnah7b UTSW 1 46236714 missense probably benign 0.02
R1962:Dnah7b UTSW 1 46242103 missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46142087 missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46242321 nonsense probably null
R2083:Dnah7b UTSW 1 46241067 missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46097992 splice site probably benign
R2172:Dnah7b UTSW 1 46124512 missense probably benign 0.12
R2239:Dnah7b UTSW 1 46201184 splice site probably benign
R2247:Dnah7b UTSW 1 46277063 missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46233915 missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46362954 missense probably benign 0.31
R2509:Dnah7b UTSW 1 46195287 missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46139741 missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46207572 missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46188687 critical splice donor site probably null
R3022:Dnah7b UTSW 1 46182423 missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46268709 missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46352873 missense probably benign 0.00
R3735:Dnah7b UTSW 1 46299875 missense probably benign 0.05
R3898:Dnah7b UTSW 1 46243257 missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46137485 missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46233711 missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46081495 missense probably benign
R4172:Dnah7b UTSW 1 46226946 missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46137418 missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46221772 missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46337594 splice site probably null
R4414:Dnah7b UTSW 1 46126680 missense probably benign 0.00
R4495:Dnah7b UTSW 1 46085632 missense probably benign 0.00
R4660:Dnah7b UTSW 1 46289536 missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46078524 missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46217157 missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46211328 missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46207656 missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46066955 missense unknown
R4780:Dnah7b UTSW 1 46353014 missense probably benign
R4828:Dnah7b UTSW 1 46128112 missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46356602 missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46195074 missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46081444 missense probably benign 0.21
R4881:Dnah7b UTSW 1 46201318 missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46290775 missense probably benign 0.04
R4960:Dnah7b UTSW 1 46233726 missense probably benign
R5000:Dnah7b UTSW 1 46099503 nonsense probably null
R5005:Dnah7b UTSW 1 46242028 missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46187363 missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46182380 nonsense probably null
R5174:Dnah7b UTSW 1 46243349 missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46358216 missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46233858 missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46373354 missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46233689 missense probably benign 0.16
R5380:Dnah7b UTSW 1 46217191 missense probably benign 0.18
R5387:Dnah7b UTSW 1 46188659 missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46358271 missense probably benign 0.01
R5426:Dnah7b UTSW 1 46242206 missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46242019 missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46109312 missense probably null
R5479:Dnah7b UTSW 1 46223105 missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46242199 missense probably benign 0.06
R5637:Dnah7b UTSW 1 46356514 missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46268764 splice site probably null
R5659:Dnah7b UTSW 1 46352849 missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46233992 missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46277120 missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46142132 missense possibly damaging 0.91
R5892:Dnah7b UTSW 1 46337593 critical splice donor site probably null
R5918:Dnah7b UTSW 1 46221643 missense probably benign
R5941:Dnah7b UTSW 1 46187290 missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46362987 missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46119398 intron probably null
R6041:Dnah7b UTSW 1 46289645 missense probably benign 0.04
R6043:Dnah7b UTSW 1 46139789 missense probably benign
R6049:Dnah7b UTSW 1 46085602 missense probably benign
R6131:Dnah7b UTSW 1 46253466 missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46290703 missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46233585 missense probably benign 0.03
R6226:Dnah7b UTSW 1 46126668 missense probably benign 0.01
R6233:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46225888 missense probably benign
R6273:Dnah7b UTSW 1 46242316 missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46340175 missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46242204 nonsense probably null
R6494:Dnah7b UTSW 1 46099431 missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46224742 missense probably benign 0.12
R6800:Dnah7b UTSW 1 46340217 missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46191788 missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46195120 missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46119268 missense probably benign 0.12
R6969:Dnah7b UTSW 1 46358238 missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46195139 critical splice donor site probably null
R7040:Dnah7b UTSW 1 46236809 missense probably benign 0.01
R7117:Dnah7b UTSW 1 46352813 critical splice acceptor site unknown
R7135:Dnah7b UTSW 1 46139710 missense not run
R7153:Dnah7b UTSW 1 46126804 missense not run
V8831:Dnah7b UTSW 1 46373298 nonsense probably null
X0023:Dnah7b UTSW 1 46303577 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGAGATTTTCTGAGGTGAGCAG -3'
(R):5'- AGGCACAGTAAAGCTTCTGTTTG -3'

Sequencing Primer
(F):5'- AGCAGTGTGTGTGGGGAC -3'
(R):5'- ACAGTAAAGCTTCTGTTTGCATCC -3'
Posted On2017-02-10