Incidental Mutation 'R5874:Gm6614'
ID455382
Institutional Source Beutler Lab
Gene Symbol Gm6614
Ensembl Gene ENSMUSG00000079263
Gene Namepredicted gene 6614
Synonyms
MMRRC Submission 044081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5874 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location141971845-142011414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141972235 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 638 (H638Q)
Ref Sequence ENSEMBL: ENSMUSP00000137696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111832] [ENSMUST00000181628] [ENSMUST00000181791]
Predicted Effect probably benign
Transcript: ENSMUST00000111832
AA Change: H638Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107463
Gene: ENSMUSG00000079263
AA Change: H638Q

DomainStartEndE-ValueType
Pfam:OATP 1 577 2.5e-156 PFAM
Pfam:MFS_1 125 402 1e-23 PFAM
Pfam:Kazal_2 425 466 4.1e-9 PFAM
transmembrane domain 580 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181628
AA Change: H658Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000137967
Gene: ENSMUSG00000079263
AA Change: H658Q

DomainStartEndE-ValueType
Pfam:OATP 19 598 2.8e-187 PFAM
Pfam:MFS_1 145 422 8e-24 PFAM
Pfam:Kazal_2 445 486 1.1e-7 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181791
AA Change: H638Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000137696
Gene: ENSMUSG00000079263
AA Change: H638Q

DomainStartEndE-ValueType
Pfam:OATP 1 578 2.3e-186 PFAM
Pfam:MFS_1 125 402 8.6e-24 PFAM
Pfam:Kazal_2 425 466 1.4e-7 PFAM
transmembrane domain 580 602 N/A INTRINSIC
Meta Mutation Damage Score 0.1188 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 98% (86/88)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik A T 9: 51,290,372 L128* probably null Het
2410131K14Rik T C 5: 118,259,439 V162A probably damaging Het
4930432E11Rik G A 7: 29,581,185 noncoding transcript Het
Adam17 T C 12: 21,329,086 D654G possibly damaging Het
Ankhd1 A T 18: 36,640,269 H1373L possibly damaging Het
Ankrd17 T C 5: 90,268,797 probably benign Het
Calu A G 6: 29,372,618 D112G probably damaging Het
Camk2a G C 18: 60,943,200 probably benign Het
Ccdc130 T A 8: 84,258,548 D364V possibly damaging Het
Cpn1 C A 19: 43,956,512 R452L probably benign Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cuedc2 C T 19: 46,331,385 V164M possibly damaging Het
Cyp2d34 T A 15: 82,619,042 D74V probably benign Het
Ddi2 A G 4: 141,695,469 S311P probably damaging Het
Ddx10 A C 9: 53,229,198 I301R possibly damaging Het
Dmpk T C 7: 19,092,082 probably benign Het
Dnah7b C T 1: 46,191,725 T1381I probably damaging Het
Dst T A 1: 34,179,589 N1703K probably damaging Het
Dtwd1 T A 2: 126,158,439 H98Q probably damaging Het
Ecel1 A C 1: 87,148,009 V769G probably benign Het
Eno4 T C 19: 58,946,806 V150A probably benign Het
Evc2 C T 5: 37,417,539 probably benign Het
Ext1 T A 15: 53,101,752 Q406L possibly damaging Het
Fam104a T A 11: 113,677,394 R78S probably damaging Het
Fam35a T C 14: 34,245,258 T114A probably benign Het
Foxf2 A G 13: 31,626,792 H238R probably benign Het
Frem2 C G 3: 53,537,489 G2407A probably benign Het
Fzd10 A G 5: 128,601,300 E28G probably benign Het
Galnt15 T C 14: 32,052,367 F363L probably damaging Het
Gm1758 C T 16: 14,507,173 noncoding transcript Het
Gm5866 C T 5: 52,582,614 noncoding transcript Het
Heatr9 T A 11: 83,514,600 M345L probably benign Het
Il23r A T 6: 67,431,645 F404Y possibly damaging Het
Lrrc8a T C 2: 30,257,136 I654T probably damaging Het
Napg A T 18: 62,978,020 K18* probably null Het
Ndst3 A T 3: 123,561,907 W573R probably damaging Het
Nin T C 12: 70,030,918 S1038G possibly damaging Het
Nudt12 T A 17: 59,010,284 R123* probably null Het
Oas1g T A 5: 120,877,018 N361Y probably benign Het
Olfr1100 A T 2: 86,978,442 M118K probably damaging Het
Olfr1351 T A 10: 79,017,357 F12I possibly damaging Het
Olfr470 T A 7: 107,845,170 I188L probably benign Het
Osbpl10 T C 9: 115,226,760 F667L probably damaging Het
Phldb2 T C 16: 45,801,625 D664G probably damaging Het
Piezo2 C T 18: 63,027,901 V2263M probably damaging Het
Pkd1l1 A G 11: 8,908,688 L615P probably damaging Het
Pnpla7 G A 2: 25,011,649 M562I probably benign Het
Ppp1r13b C A 12: 111,844,989 R155L probably damaging Het
Pygb C T 2: 150,786,878 P4L probably benign Het
Rbm44 T C 1: 91,156,840 probably null Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Rin3 A G 12: 102,389,843 Y801C probably damaging Het
Rnf112 A G 11: 61,449,447 V619A probably damaging Het
Rnf182 A G 13: 43,668,087 E38G probably benign Het
Scgb2b24 T A 7: 33,737,405 Y94F probably damaging Het
Serac1 C A 17: 6,043,913 probably benign Het
Slc6a19 A T 13: 73,684,368 V402D probably damaging Het
Slco2b1 T A 7: 99,667,094 M410L probably benign Het
Smarca2 T C 19: 26,776,069 probably benign Het
Sned1 A G 1: 93,265,345 Y409C probably damaging Het
Sorcs2 A G 5: 36,229,211 V161A probably damaging Het
Sptb T C 12: 76,598,727 E2029G possibly damaging Het
Stx7 T A 10: 24,182,761 probably null Het
Taf4b T C 18: 14,804,554 V228A probably benign Het
Tbc1d1 A G 5: 64,349,930 *1163W probably null Het
Tor4a G A 2: 25,194,835 A352V probably damaging Het
Trpm4 A G 7: 45,327,749 F81S probably damaging Het
Ttn T A 2: 76,950,092 D1105V probably damaging Het
Zfp551 A G 7: 12,416,174 L436P probably damaging Het
Zfp975 G T 7: 42,662,888 D100E probably benign Het
Zswim3 A G 2: 164,820,112 I171V probably benign Het
Zwint C T 10: 72,656,462 probably benign Het
Other mutations in Gm6614
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Gm6614 APN 6 141990408 missense probably benign 0.00
IGL01548:Gm6614 APN 6 141992512 missense possibly damaging 0.82
IGL01552:Gm6614 APN 6 141987706 missense possibly damaging 0.54
IGL02207:Gm6614 APN 6 141990432 missense possibly damaging 0.80
IGL02227:Gm6614 APN 6 141993675 nonsense probably null
IGL02547:Gm6614 APN 6 141990390 missense probably damaging 0.99
IGL02678:Gm6614 APN 6 142008718 missense probably damaging 1.00
IGL02695:Gm6614 APN 6 141987760 missense probably damaging 1.00
IGL02851:Gm6614 APN 6 142003471 missense probably damaging 1.00
IGL02881:Gm6614 APN 6 141972243 missense probably benign 0.00
IGL02898:Gm6614 APN 6 141994297 missense probably benign 0.01
IGL03036:Gm6614 APN 6 142008607 missense possibly damaging 0.69
IGL03065:Gm6614 APN 6 141992502 missense probably damaging 0.99
IGL03300:Gm6614 APN 6 141994806 missense probably damaging 0.96
R0020:Gm6614 UTSW 6 141972350 missense possibly damaging 0.93
R0020:Gm6614 UTSW 6 141972350 missense possibly damaging 0.93
R0049:Gm6614 UTSW 6 141990421 missense probably benign
R0049:Gm6614 UTSW 6 141990421 missense probably benign
R0149:Gm6614 UTSW 6 141992477 missense probably benign 0.01
R0270:Gm6614 UTSW 6 141972411 missense possibly damaging 0.88
R0360:Gm6614 UTSW 6 141982327 splice site probably benign
R0420:Gm6614 UTSW 6 141985477 splice site probably benign
R0737:Gm6614 UTSW 6 142003428 missense possibly damaging 0.79
R1344:Gm6614 UTSW 6 141985618 missense probably damaging 1.00
R1464:Gm6614 UTSW 6 141992517 nonsense probably null
R1464:Gm6614 UTSW 6 141992517 nonsense probably null
R1590:Gm6614 UTSW 6 141980872 missense probably benign 0.00
R1666:Gm6614 UTSW 6 141982049 splice site probably null
R1669:Gm6614 UTSW 6 141987689 missense probably benign 0.39
R1862:Gm6614 UTSW 6 142003423 missense possibly damaging 0.95
R1882:Gm6614 UTSW 6 141993637 critical splice donor site probably null
R2134:Gm6614 UTSW 6 141980978 missense probably damaging 1.00
R2155:Gm6614 UTSW 6 141980944 missense probably damaging 1.00
R2163:Gm6614 UTSW 6 141980938 missense possibly damaging 0.55
R2227:Gm6614 UTSW 6 141992361 missense possibly damaging 0.67
R2382:Gm6614 UTSW 6 141990480 missense probably benign 0.00
R3773:Gm6614 UTSW 6 141972335 missense probably benign 0.17
R4869:Gm6614 UTSW 6 141987766 missense probably damaging 1.00
R4975:Gm6614 UTSW 6 141980873 missense probably benign 0.30
R5061:Gm6614 UTSW 6 142008688 missense probably benign 0.03
R5079:Gm6614 UTSW 6 141972347 missense probably benign 0.00
R5312:Gm6614 UTSW 6 141972332 missense probably benign 0.00
R5691:Gm6614 UTSW 6 141994855 nonsense probably null
R5945:Gm6614 UTSW 6 141994282 missense probably damaging 1.00
R6478:Gm6614 UTSW 6 141993642 missense possibly damaging 0.93
R7305:Gm6614 UTSW 6 141992494 missense probably damaging 1.00
R7325:Gm6614 UTSW 6 141989225 missense probably damaging 0.98
R7427:Gm6614 UTSW 6 142003508 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGCCAATTTTATGGTAAGTGTCCAC -3'
(R):5'- GCATTTACCTTGGACTACCTGC -3'

Sequencing Primer
(F):5'- CAAGTTGACTAAGGGACACGTCTTG -3'
(R):5'- TTGGACTACCTGCAGCACTAAGAG -3'
Posted On2017-02-10