Incidental Mutation 'R5875:Sdk2'
ID455487
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Namesidekick cell adhesion molecule 2
Synonyms5330435L01Rik, 4632412F08Rik
MMRRC Submission 044082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5875 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location113776374-114067046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 113830059 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1348 (T1348K)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627]
Predicted Effect probably benign
Transcript: ENSMUST00000041627
AA Change: T1348K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: T1348K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125879
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik A G 2: 127,186,817 V154A possibly damaging Het
2900055J20Rik T A 18: 40,257,394 probably benign Het
4931417E11Rik T C 6: 73,469,045 I174V possibly damaging Het
4933417A18Rik T G 13: 34,932,446 C59W probably damaging Het
Abcc1 A G 16: 14,467,037 E1250G possibly damaging Het
Ajap1 A C 4: 153,432,341 I181R probably damaging Het
Akap9 A G 5: 4,077,285 Y3711C probably benign Het
Arl1 T C 10: 88,741,979 S137P probably benign Het
Atp6v0a2 G A 5: 124,716,327 V583I probably benign Het
Cdca7 T A 2: 72,483,557 M230K probably benign Het
Chd9 A T 8: 91,051,836 D2841V probably damaging Het
Chp1 T A 2: 119,571,815 F90Y probably damaging Het
Ckap5 A G 2: 91,560,861 T345A probably benign Het
Clca4b A C 3: 144,922,889 S352R probably benign Het
Cmya5 A G 13: 93,095,184 V1132A probably benign Het
Crb2 T A 2: 37,787,254 probably null Het
Crhbp A G 13: 95,443,796 F99L probably benign Het
Dnmt3l A T 10: 78,053,938 M210L probably benign Het
Dyrk2 T A 10: 118,860,697 R219W probably damaging Het
Exosc1 A G 19: 41,928,103 I78T probably damaging Het
Exosc9 T C 3: 36,561,193 probably null Het
Frmd5 A G 2: 121,558,478 probably benign Het
Gata2 T C 6: 88,202,491 L315P probably damaging Het
Gm17067 G A 7: 42,708,046 T344I probably benign Het
Gm4884 A T 7: 41,042,936 T110S possibly damaging Het
Hapln3 T C 7: 79,121,973 E56G probably benign Het
Helq A C 5: 100,796,470 I258S probably damaging Het
Hoxd10 T C 2: 74,692,082 Y35H possibly damaging Het
Inpp5b T C 4: 124,780,406 V302A possibly damaging Het
Inpp5d T A 1: 87,717,974 I1027N possibly damaging Het
Ints2 T C 11: 86,238,312 S482G probably benign Het
Itih1 C T 14: 30,929,530 V902I probably benign Het
Kif27 T C 13: 58,311,104 N971S probably benign Het
Klra17 T C 6: 129,874,828 D27G probably benign Het
Leo1 G C 9: 75,450,560 R412S probably damaging Het
Lonrf2 T C 1: 38,807,047 N348S probably benign Het
Lpp G A 16: 24,608,309 G62E probably benign Het
Lyn G A 4: 3,745,631 probably null Het
Macf1 T A 4: 123,432,314 N5128I possibly damaging Het
Mapk7 T A 11: 61,493,698 I61L probably benign Het
Mindy1 T C 3: 95,294,814 V334A probably damaging Het
Muc20 G A 16: 32,793,819 T396I possibly damaging Het
Myo5b A T 18: 74,707,902 probably null Het
Noc4l A C 5: 110,651,310 probably null Het
Oas1c A G 5: 120,805,562 Y171H probably damaging Het
Pclo A T 5: 14,680,600 probably benign Het
Pmpcb G A 5: 21,742,946 E216K probably benign Het
Pskh1 G A 8: 105,913,099 R137Q possibly damaging Het
Ptprb T G 10: 116,348,166 W1628G probably benign Het
Ranbp3 T A 17: 56,707,955 probably null Het
Rnf165 T C 18: 77,563,181 probably benign Het
Sart1 T C 19: 5,383,795 D338G probably damaging Het
Scn8a T A 15: 100,972,822 Y251* probably null Het
Sec16a A G 2: 26,433,367 Y1272H probably damaging Het
Slc26a1 A T 5: 108,672,037 L432Q probably damaging Het
Susd1 A T 4: 59,412,203 F117I possibly damaging Het
Taf5 A T 19: 47,076,110 Y465F probably damaging Het
Tcstv1 T A 13: 119,894,094 M1L probably benign Het
Tectb A G 19: 55,189,626 D193G possibly damaging Het
Tirap G A 9: 35,189,169 P73L probably damaging Het
Tm6sf2 A G 8: 70,075,389 D86G possibly damaging Het
Tmem161b A T 13: 84,294,858 H481L probably damaging Het
Tnrc6c G A 11: 117,759,708 V1763I probably damaging Het
Ubxn1 T C 19: 8,872,220 S75P probably benign Het
Uhrf2 A G 19: 30,089,302 K709E probably damaging Het
Vmn2r101 T A 17: 19,588,830 Y74N probably damaging Het
Xirp2 A G 2: 67,505,080 E81G probably benign Het
Zbtb45 A G 7: 13,008,310 V7A possibly damaging Het
Zfp668 C A 7: 127,866,302 R570L possibly damaging Het
Zmiz1 T A 14: 25,635,966 M125K possibly damaging Het
Zmiz2 T C 11: 6,405,072 L913P probably damaging Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113854384 missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113830842 missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113843080 missense probably benign
IGL01316:Sdk2 APN 11 113867965 missense probably benign 0.09
IGL01614:Sdk2 APN 11 113793858 missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113838532 missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113838494 missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113834830 missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113834813 splice site probably benign
IGL02543:Sdk2 APN 11 113868921 missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113851842 missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113821626 missense probably benign 0.00
IGL03122:Sdk2 APN 11 113842068 missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113850984 missense probably benign 0.19
IGL03222:Sdk2 APN 11 113838431 missense probably benign 0.01
IGL03310:Sdk2 APN 11 113793325 missense possibly damaging 0.77
ANU05:Sdk2 UTSW 11 113843080 missense probably benign
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113827086 missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113903144 splice site probably benign
R0386:Sdk2 UTSW 11 113893464 missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113829967 missense probably benign 0.04
R0409:Sdk2 UTSW 11 113850891 splice site probably benign
R0416:Sdk2 UTSW 11 113803203 missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113791466 missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113781010 missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113794920 splice site probably null
R0711:Sdk2 UTSW 11 113903144 splice site probably benign
R0717:Sdk2 UTSW 11 113832326 missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R0831:Sdk2 UTSW 11 113832258 missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113821415 missense probably benign 0.00
R0865:Sdk2 UTSW 11 113850922 missense probably benign 0.12
R0930:Sdk2 UTSW 11 113838445 missense probably benign 0.01
R0964:Sdk2 UTSW 11 113806417 splice site probably benign
R1051:Sdk2 UTSW 11 113838646 synonymous silent
R1052:Sdk2 UTSW 11 113838646 synonymous silent
R1054:Sdk2 UTSW 11 113838646 synonymous silent
R1055:Sdk2 UTSW 11 113838646 synonymous silent
R1077:Sdk2 UTSW 11 113838646 synonymous silent
R1079:Sdk2 UTSW 11 113838646 synonymous silent
R1115:Sdk2 UTSW 11 113838646 synonymous silent
R1186:Sdk2 UTSW 11 113838646 synonymous silent
R1187:Sdk2 UTSW 11 113838646 synonymous silent
R1337:Sdk2 UTSW 11 113832331 missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113838646 synonymous silent
R1433:Sdk2 UTSW 11 113795045 missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113893575 splice site probably benign
R1514:Sdk2 UTSW 11 113838646 synonymous silent
R1529:Sdk2 UTSW 11 113838646 synonymous silent
R1596:Sdk2 UTSW 11 113838609 splice site probably benign
R1680:Sdk2 UTSW 11 113791436 missense possibly damaging 0.47
R1680:Sdk2 UTSW 11 113838646 synonymous silent
R1770:Sdk2 UTSW 11 113793741 missense probably benign 0.05
R1858:Sdk2 UTSW 11 113838646 synonymous silent
R1866:Sdk2 UTSW 11 113838646 synonymous silent
R1874:Sdk2 UTSW 11 113834956 missense probably benign 0.00
R1899:Sdk2 UTSW 11 113838646 synonymous silent
R1905:Sdk2 UTSW 11 113838646 synonymous silent
R1907:Sdk2 UTSW 11 113838646 synonymous silent
R1913:Sdk2 UTSW 11 113856726 missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113781017 nonsense probably null
R2055:Sdk2 UTSW 11 113850954 missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113854332 missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113943122 missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113830794 missense probably benign 0.44
R3720:Sdk2 UTSW 11 113800244 missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113856696 nonsense probably null
R4037:Sdk2 UTSW 11 113795055 missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113866989 splice site probably null
R4717:Sdk2 UTSW 11 113854369 missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113827054 missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113821382 nonsense probably null
R4924:Sdk2 UTSW 11 113857758 missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113793761 missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113850982 missense probably benign 0.01
R5239:Sdk2 UTSW 11 113868033 missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113825086 missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113867031 missense probably benign 0.31
R5535:Sdk2 UTSW 11 113943158 missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113851714 missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113833179 missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113851800 missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113868952 missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113827116 missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113854273 missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113834984 missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113851882 missense probably damaging 0.96
R5953:Sdk2 UTSW 11 113793744 missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113943254 missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113830063 missense probably benign 0.00
R6116:Sdk2 UTSW 11 113854364 missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113793755 missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R6383:Sdk2 UTSW 11 113832265 missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113867934 missense probably benign 0.43
R6835:Sdk2 UTSW 11 113830048 missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113780929 missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113903120 missense probably benign 0.03
R7000:Sdk2 UTSW 11 113803169 missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113834905 missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113842690 nonsense probably null
R7177:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113838489 missense probably damaging 0.98
V1662:Sdk2 UTSW 11 113834908 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAAGCAATGCCGTTCCCC -3'
(R):5'- TGTGACCAGAAGAATGTCACAC -3'

Sequencing Primer
(F):5'- CTGTGTGGGCTCCAGAAG -3'
(R):5'- TGTCACACAGCCAAACAGGAG -3'
Posted On2017-02-10