Incidental Mutation 'R5877:Lhx1'
ID455613
Institutional Source Beutler Lab
Gene Symbol Lhx1
Ensembl Gene ENSMUSG00000018698
Gene NameLIM homeobox protein 1
SynonymsLim1
MMRRC Submission 044083-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5877 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location84518284-84525535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84522239 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 30 (D30Y)
Ref Sequence ENSEMBL: ENSMUSP00000090503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018842] [ENSMUST00000092827] [ENSMUST00000184646]
Predicted Effect probably damaging
Transcript: ENSMUST00000018842
AA Change: D74Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018842
Gene: ENSMUSG00000018698
AA Change: D74Y

DomainStartEndE-ValueType
LIM 3 54 5.51e-17 SMART
LIM 62 117 4.24e-18 SMART
low complexity region 137 156 N/A INTRINSIC
HOX 180 242 1.33e-22 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092827
AA Change: D30Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090503
Gene: ENSMUSG00000018698
AA Change: D30Y

DomainStartEndE-ValueType
LIM 18 73 4.24e-18 SMART
low complexity region 93 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176503
SMART Domains Protein: ENSMUSP00000135334
Gene: ENSMUSG00000018698

DomainStartEndE-ValueType
Pfam:Homeobox 1 17 5.3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184646
SMART Domains Protein: ENSMUSP00000138899
Gene: ENSMUSG00000018698

DomainStartEndE-ValueType
low complexity region 46 65 N/A INTRINSIC
HOX 89 151 6.8e-25 SMART
low complexity region 224 236 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
Meta Mutation Damage Score 0.386 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large protein family which contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor important for the development of the renal and urogenital systems. This gene is a candidate for Mayer-Rokitansky-Kuster-Hauser syndrome, a disorder characterized by anomalies in the female genital tract. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygotes for targeted null mutations are small, fail to develop head structures anterior to rhombomere 3 in the hindbrain, lack kidneys and gonads, and show aberrant trajectories of limb motor axons. Most mutants die around embryonic day 10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik G T 18: 77,643,206 probably null Het
Adam6b A T 12: 113,490,202 H213L probably damaging Het
Alk A G 17: 71,967,526 W597R probably damaging Het
Ash1l G A 3: 88,981,584 V257I probably benign Het
Atp9b C T 18: 80,752,789 V957I probably benign Het
Birc3 A C 9: 7,849,346 C576G probably damaging Het
Brca2 T C 5: 150,543,221 M2150T possibly damaging Het
C3ar1 T G 6: 122,850,622 D212A probably benign Het
Cacna1s T C 1: 136,100,667 F914S probably damaging Het
Camk1d T C 2: 5,565,665 I62V probably benign Het
Caskin1 T C 17: 24,505,265 M1009T possibly damaging Het
Casp2 A G 6: 42,276,637 probably benign Het
Cd2bp2 T A 7: 127,194,799 Y106F probably damaging Het
Celsr3 G A 9: 108,845,727 C2763Y probably damaging Het
Cyp2g1 T G 7: 26,816,640 L310V possibly damaging Het
Dusp22 G A 13: 30,707,961 V99M probably damaging Het
Fam131b G A 6: 42,320,979 S92L probably benign Het
Fbxw10 A T 11: 62,857,716 N390Y probably damaging Het
Flg2 A T 3: 93,203,449 H928L unknown Het
Gapdhs T C 7: 30,732,347 T280A probably damaging Het
Hdac11 A G 6: 91,157,542 K50E probably damaging Het
Hif3a G T 7: 17,051,146 A181E probably damaging Het
Ikbkap A T 4: 56,787,807 W375R probably damaging Het
Itgb8 A G 12: 119,202,536 S87P probably benign Het
Klhl12 T A 1: 134,483,820 Y302* probably null Het
Mrpl40 A G 16: 18,872,385 Y148H probably damaging Het
Myh13 A T 11: 67,353,658 H1007L possibly damaging Het
Nhlrc2 T C 19: 56,570,584 I167T probably damaging Het
Nxpe3 A T 16: 55,866,201 I148K probably damaging Het
Odf2l A G 3: 145,129,010 probably null Het
Otud7b C T 3: 96,151,960 R347* probably null Het
P3h4 G T 11: 100,414,017 H181Q probably benign Het
P4htm T A 9: 108,583,733 Y180F possibly damaging Het
Pcna-ps2 A G 19: 9,284,099 I241V probably benign Het
Pcnx2 T C 8: 125,753,728 S1947G probably damaging Het
Piezo2 T C 18: 63,113,934 I336V probably benign Het
Plcd1 T C 9: 119,076,172 D157G probably damaging Het
Plekhm2 A C 4: 141,639,693 I212S probably damaging Het
Pmvk G T 3: 89,464,369 C57F probably benign Het
Pole T C 5: 110,332,463 S91P probably benign Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Ppp4r3b A T 11: 29,209,356 D570V probably damaging Het
Pxdn T A 12: 30,003,046 I1074N probably damaging Het
Ralgapa2 A T 2: 146,388,569 D1025E probably damaging Het
Ralgps1 A G 2: 33,243,628 probably benign Het
Rasal1 C T 5: 120,679,070 probably benign Het
Rps2 A T 17: 24,720,916 probably benign Het
Scn7a G C 2: 66,699,873 Y709* probably null Het
Skint1 T A 4: 112,021,523 C217* probably null Het
Slc50a1 T C 3: 89,269,153 Y82C probably damaging Het
Slc9a4 T C 1: 40,612,263 V567A probably benign Het
Snx27 A T 3: 94,502,963 W469R probably damaging Het
Sos2 A G 12: 69,596,795 L937P probably damaging Het
Ssh1 T C 5: 113,943,120 T728A probably benign Het
Tnfrsf8 G A 4: 145,292,687 R193C probably benign Het
Usp33 T A 3: 152,379,476 M583K possibly damaging Het
Usp33 G A 3: 152,379,596 C623Y probably damaging Het
Wdfy3 T C 5: 101,869,989 I2562V probably damaging Het
Wnk2 T C 13: 49,067,306 D1175G probably damaging Het
Zcchc11 T C 4: 108,512,923 V673A probably damaging Het
Zfp341 G A 2: 154,632,289 E338K probably damaging Het
Zfp398 A G 6: 47,840,704 probably benign Het
Zp2 T A 7: 120,133,339 K661N probably null Het
Other mutations in Lhx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Lhx1 APN 11 84519652 missense probably damaging 0.97
R1346:Lhx1 UTSW 11 84522079 missense possibly damaging 0.55
R1565:Lhx1 UTSW 11 84519821 missense probably benign 0.00
R1806:Lhx1 UTSW 11 84524141 missense probably damaging 1.00
R2148:Lhx1 UTSW 11 84519821 missense probably benign 0.00
R2449:Lhx1 UTSW 11 84521738 missense probably damaging 1.00
R3721:Lhx1 UTSW 11 84521828 missense probably damaging 1.00
R3793:Lhx1 UTSW 11 84521900 missense probably benign 0.01
R4940:Lhx1 UTSW 11 84519909 nonsense probably null
R5178:Lhx1 UTSW 11 84520388 missense possibly damaging 0.69
R6366:Lhx1 UTSW 11 84522208 missense probably damaging 1.00
R6551:Lhx1 UTSW 11 84521913 missense probably benign 0.23
R7060:Lhx1 UTSW 11 84520282 critical splice donor site probably null
R7106:Lhx1 UTSW 11 84522077 missense probably benign 0.00
R7133:Lhx1 UTSW 11 84519920 missense probably benign 0.00
R7161:Lhx1 UTSW 11 84519872 missense probably damaging 1.00
R7290:Lhx1 UTSW 11 84521877 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTGTTCTCTTTGGCGACAC -3'
(R):5'- GGGGCCTTAACTCTAACCGAATG -3'

Sequencing Primer
(F):5'- GACACTGCTGTTACTCAGGTAATC -3'
(R):5'- AACTCTAACCGAATGTATTTTCCTC -3'
Posted On2017-02-10