Incidental Mutation 'R5877:Sos2'
ID455616
Institutional Source Beutler Lab
Gene Symbol Sos2
Ensembl Gene ENSMUSG00000034801
Gene NameSOS Ras/Rho guanine nucleotide exchange factor 2
Synonyms
MMRRC Submission 044083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5877 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69583762-69681852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69596795 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 937 (L937P)
Ref Sequence ENSEMBL: ENSMUSP00000138793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035773] [ENSMUST00000182396] [ENSMUST00000183277]
PDB Structure
ORIENTATION OF PEPTIDE FRAGMENTS FROM SOS PROTEINS BOUND TO THE N-TERMINAL SH3 DOMAIN OF GRB2 DETERMINED BY NMR SPECTROSCOPY [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000035773
AA Change: L936P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044866
Gene: ENSMUSG00000034801
AA Change: L936P

DomainStartEndE-ValueType
Pfam:Histone 54 169 3.7e-13 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182396
AA Change: L904P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138589
Gene: ENSMUSG00000034801
AA Change: L904P

DomainStartEndE-ValueType
Pfam:Histone 97 169 1e-9 PFAM
Pfam:RhoGEF 203 344 1.6e-12 PFAM
PH 410 514 1.54e-14 SMART
RasGEFN 562 707 5.8e-52 SMART
RasGEF 742 986 2.51e-92 SMART
low complexity region 1046 1066 N/A INTRINSIC
low complexity region 1111 1119 N/A INTRINSIC
low complexity region 1140 1159 N/A INTRINSIC
low complexity region 1167 1192 N/A INTRINSIC
low complexity region 1221 1236 N/A INTRINSIC
low complexity region 1243 1259 N/A INTRINSIC
low complexity region 1268 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182838
Predicted Effect probably damaging
Transcript: ENSMUST00000183277
AA Change: L937P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138793
Gene: ENSMUSG00000034801
AA Change: L937P

DomainStartEndE-ValueType
Pfam:Histone 97 169 8.9e-11 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Meta Mutation Damage Score 0.454 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in this gene are associated with Noonan Syndrome-9. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal embryonic and adult histopathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik G T 18: 77,643,206 probably null Het
Adam6b A T 12: 113,490,202 H213L probably damaging Het
Alk A G 17: 71,967,526 W597R probably damaging Het
Ash1l G A 3: 88,981,584 V257I probably benign Het
Atp9b C T 18: 80,752,789 V957I probably benign Het
Birc3 A C 9: 7,849,346 C576G probably damaging Het
Brca2 T C 5: 150,543,221 M2150T possibly damaging Het
C3ar1 T G 6: 122,850,622 D212A probably benign Het
Cacna1s T C 1: 136,100,667 F914S probably damaging Het
Camk1d T C 2: 5,565,665 I62V probably benign Het
Caskin1 T C 17: 24,505,265 M1009T possibly damaging Het
Casp2 A G 6: 42,276,637 probably benign Het
Cd2bp2 T A 7: 127,194,799 Y106F probably damaging Het
Celsr3 G A 9: 108,845,727 C2763Y probably damaging Het
Cyp2g1 T G 7: 26,816,640 L310V possibly damaging Het
Dusp22 G A 13: 30,707,961 V99M probably damaging Het
Fam131b G A 6: 42,320,979 S92L probably benign Het
Fbxw10 A T 11: 62,857,716 N390Y probably damaging Het
Flg2 A T 3: 93,203,449 H928L unknown Het
Gapdhs T C 7: 30,732,347 T280A probably damaging Het
Hdac11 A G 6: 91,157,542 K50E probably damaging Het
Hif3a G T 7: 17,051,146 A181E probably damaging Het
Ikbkap A T 4: 56,787,807 W375R probably damaging Het
Itgb8 A G 12: 119,202,536 S87P probably benign Het
Klhl12 T A 1: 134,483,820 Y302* probably null Het
Lhx1 C A 11: 84,522,239 D30Y probably damaging Het
Mrpl40 A G 16: 18,872,385 Y148H probably damaging Het
Myh13 A T 11: 67,353,658 H1007L possibly damaging Het
Nhlrc2 T C 19: 56,570,584 I167T probably damaging Het
Nxpe3 A T 16: 55,866,201 I148K probably damaging Het
Odf2l A G 3: 145,129,010 probably null Het
Otud7b C T 3: 96,151,960 R347* probably null Het
P3h4 G T 11: 100,414,017 H181Q probably benign Het
P4htm T A 9: 108,583,733 Y180F possibly damaging Het
Pcna-ps2 A G 19: 9,284,099 I241V probably benign Het
Pcnx2 T C 8: 125,753,728 S1947G probably damaging Het
Piezo2 T C 18: 63,113,934 I336V probably benign Het
Plcd1 T C 9: 119,076,172 D157G probably damaging Het
Plekhm2 A C 4: 141,639,693 I212S probably damaging Het
Pmvk G T 3: 89,464,369 C57F probably benign Het
Pole T C 5: 110,332,463 S91P probably benign Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Ppp4r3b A T 11: 29,209,356 D570V probably damaging Het
Pxdn T A 12: 30,003,046 I1074N probably damaging Het
Ralgapa2 A T 2: 146,388,569 D1025E probably damaging Het
Ralgps1 A G 2: 33,243,628 probably benign Het
Rasal1 C T 5: 120,679,070 probably benign Het
Rps2 A T 17: 24,720,916 probably benign Het
Scn7a G C 2: 66,699,873 Y709* probably null Het
Skint1 T A 4: 112,021,523 C217* probably null Het
Slc50a1 T C 3: 89,269,153 Y82C probably damaging Het
Slc9a4 T C 1: 40,612,263 V567A probably benign Het
Snx27 A T 3: 94,502,963 W469R probably damaging Het
Ssh1 T C 5: 113,943,120 T728A probably benign Het
Tnfrsf8 G A 4: 145,292,687 R193C probably benign Het
Usp33 T A 3: 152,379,476 M583K possibly damaging Het
Usp33 G A 3: 152,379,596 C623Y probably damaging Het
Wdfy3 T C 5: 101,869,989 I2562V probably damaging Het
Wnk2 T C 13: 49,067,306 D1175G probably damaging Het
Zcchc11 T C 4: 108,512,923 V673A probably damaging Het
Zfp341 G A 2: 154,632,289 E338K probably damaging Het
Zfp398 A G 6: 47,840,704 probably benign Het
Zp2 T A 7: 120,133,339 K661N probably null Het
Other mutations in Sos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Sos2 APN 12 69616849 splice site probably benign
IGL01348:Sos2 APN 12 69618092 missense probably damaging 0.99
IGL01360:Sos2 APN 12 69590800 missense probably benign 0.00
IGL01586:Sos2 APN 12 69607398 missense probably damaging 1.00
IGL01721:Sos2 APN 12 69603867 missense probably damaging 0.99
IGL02024:Sos2 APN 12 69618048 splice site probably benign
IGL02347:Sos2 APN 12 69596746 missense probably benign
IGL02419:Sos2 APN 12 69616990 missense probably benign
IGL02684:Sos2 APN 12 69596666 missense probably damaging 1.00
IGL02719:Sos2 APN 12 69617184 missense probably benign 0.00
IGL03099:Sos2 APN 12 69616359 missense probably damaging 1.00
PIT4131001:Sos2 UTSW 12 69618077 missense probably benign
R0038:Sos2 UTSW 12 69596693 missense probably damaging 1.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0326:Sos2 UTSW 12 69635685 missense probably damaging 1.00
R1386:Sos2 UTSW 12 69614658 missense probably damaging 1.00
R1472:Sos2 UTSW 12 69585316 unclassified probably null
R1534:Sos2 UTSW 12 69616955 missense probably damaging 1.00
R1861:Sos2 UTSW 12 69617363 missense probably damaging 1.00
R1934:Sos2 UTSW 12 69648541 missense probably damaging 0.99
R1964:Sos2 UTSW 12 69616862 missense possibly damaging 0.51
R2402:Sos2 UTSW 12 69596799 missense possibly damaging 0.95
R2516:Sos2 UTSW 12 69650659 missense probably damaging 0.99
R2571:Sos2 UTSW 12 69635718 missense possibly damaging 0.95
R3423:Sos2 UTSW 12 69603553 missense probably damaging 1.00
R4435:Sos2 UTSW 12 69614699 missense possibly damaging 0.79
R4508:Sos2 UTSW 12 69635661 nonsense probably null
R4595:Sos2 UTSW 12 69616889 missense probably damaging 1.00
R4606:Sos2 UTSW 12 69614606 intron probably benign
R4691:Sos2 UTSW 12 69616328 missense probably damaging 1.00
R4716:Sos2 UTSW 12 69607371 missense probably benign 0.04
R4863:Sos2 UTSW 12 69640154 missense probably benign 0.04
R5179:Sos2 UTSW 12 69650728 nonsense probably null
R5319:Sos2 UTSW 12 69627284 missense probably benign 0.22
R5694:Sos2 UTSW 12 69590915 missense probably damaging 0.96
R6363:Sos2 UTSW 12 69632111 missense probably benign 0.00
R6465:Sos2 UTSW 12 69596775 missense probably benign 0.01
R6817:Sos2 UTSW 12 69618161 missense probably benign 0.32
R6822:Sos2 UTSW 12 69650649 missense probably damaging 1.00
R7015:Sos2 UTSW 12 69585235 missense probably benign 0.43
R7562:Sos2 UTSW 12 69635638 missense probably benign 0.12
R7570:Sos2 UTSW 12 69590880 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGTGACACTCTTTAGCAAC -3'
(R):5'- TGTCTTCACCTTTCAGGAGTTAG -3'

Sequencing Primer
(F):5'- GTGACACTCTTTAGCAACTCCATTGG -3'
(R):5'- CACCTTTCAGGAGTTAGAACGCTG -3'
Posted On2017-02-10