Incidental Mutation 'R5879:Zc3h6'
ID455697
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Namezinc finger CCCH type containing 6
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R5879 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location128967402-129018563 bp(+) (GRCm38)
Type of Mutationunclassified (3646 bp from exon)
DNA Base Change (assembly) A to G at 128997776 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110319] [ENSMUST00000110320]
Predicted Effect probably null
Transcript: ENSMUST00000110319
SMART Domains Protein: ENSMUSP00000105948
Gene: ENSMUSG00000042851

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110320
AA Change: S170G

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: S170G

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,658 L87P probably damaging Het
Aldh16a1 C T 7: 45,147,506 W66* probably null Het
Arhgap39 T C 15: 76,751,807 D76G probably damaging Het
Arhgef2 G A 3: 88,643,617 probably null Het
C1qtnf2 T C 11: 43,486,008 M99T probably damaging Het
Eml3 G A 19: 8,935,015 C392Y possibly damaging Het
Ephb4 C A 5: 137,360,416 P287Q probably benign Het
Fat4 G T 3: 38,887,336 R126L probably benign Het
Flt3 T C 5: 147,334,909 M858V probably damaging Het
Gm13083 A T 4: 143,617,591 Y487F possibly damaging Het
Gprin3 A C 6: 59,354,713 I203R probably benign Het
Insr G T 8: 3,198,173 Y457* probably null Het
Ipo13 G A 4: 117,903,203 T649I possibly damaging Het
Krba1 A G 6: 48,415,744 D818G possibly damaging Het
Llgl1 G A 11: 60,712,980 G1016R probably benign Het
Loxl4 A G 19: 42,607,627 V142A probably benign Het
Mthfd1 A G 12: 76,294,218 I464V probably benign Het
Mycs C A X: 5,468,077 K316N probably damaging Het
Ncor2 A G 5: 125,026,775 probably benign Het
Nlrc3 A G 16: 3,964,045 F516S probably damaging Het
Oacyl A G 18: 65,749,672 S540G probably damaging Het
Olfml2a A T 2: 38,960,230 T653S probably damaging Het
Olfr285 C T 15: 98,313,488 V21I probably benign Het
Pcnx2 A T 8: 125,773,946 N1468K probably damaging Het
Plbd1 A G 6: 136,634,505 I258T probably damaging Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prop1 C T 11: 50,953,326 V27M probably damaging Het
Rfx4 T G 10: 84,814,761 probably null Het
Rgs11 C T 17: 26,203,463 probably benign Het
Slc6a5 T A 7: 49,945,512 F541I probably damaging Het
Srgap3 A T 6: 112,722,846 V1057E possibly damaging Het
Synpo2 A T 3: 123,114,297 W457R probably damaging Het
Tet2 T A 3: 133,487,960 N238Y possibly damaging Het
Tiam2 T A 17: 3,437,265 M687K probably damaging Het
Ticrr A G 7: 79,696,690 E1866G probably benign Het
Tspan8 T C 10: 115,833,251 S64P possibly damaging Het
Ugt2b37 C T 5: 87,254,406 G122D probably benign Het
Uqcrc2 A G 7: 120,637,888 E53G probably damaging Het
Vcan T C 13: 89,703,952 D963G probably damaging Het
Vmn2r24 T A 6: 123,787,267 Y368N possibly damaging Het
Wdr5 A G 2: 27,528,311 T208A probably benign Het
Zbtb18 A G 1: 177,448,370 Y423C probably damaging Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 129011875 missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 129017378 missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128997685 missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128993226 missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 129016581 missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 129015611 missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128997795 missense probably damaging 0.98
R0336:Zc3h6 UTSW 2 129015412 missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 129014827 missense probably benign 0.00
R0538:Zc3h6 UTSW 2 129017223 missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 129006816 missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 129017136 missense probably benign 0.00
R1528:Zc3h6 UTSW 2 129017069 missense probably benign 0.01
R1698:Zc3h6 UTSW 2 129017358 missense probably benign
R1712:Zc3h6 UTSW 2 129016734 missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 129016620 missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128997795 missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 129006086 missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 129015618 missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128967830 missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 129014709 missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128993202 missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 129015460 missense probably benign 0.43
R2899:Zc3h6 UTSW 2 129002232 missense probably benign 0.00
R3711:Zc3h6 UTSW 2 129017331 missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128997792 missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 129016140 missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 129002240 missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 129010433 missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 129017309 missense probably benign 0.00
R5125:Zc3h6 UTSW 2 129014479 missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128993452 intron probably benign
R5802:Zc3h6 UTSW 2 129015559 missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128993277 missense probably benign 0.29
R5950:Zc3h6 UTSW 2 128997790 nonsense probably null
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 129015421 missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128993411 missense unknown
R7340:Zc3h6 UTSW 2 128993190 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCCTAGCATAGACGTATATCAGGAAG -3'
(R):5'- AGGTCTACACGGTACAGAAAC -3'

Sequencing Primer
(F):5'- GACGTATATCAGGAAGTTACATGAC -3'
(R):5'- GAAGCCACAAGAATGAGCTAATTTTG -3'
Posted On2017-02-10