Incidental Mutation 'R5051:Zap70'
ID455741
Institutional Source Beutler Lab
Gene Symbol Zap70
Ensembl Gene ENSMUSG00000026117
Gene Namezeta-chain (TCR) associated protein kinase
SynonymsZAP-70, TZK, Srk
MMRRC Submission 042641-MU
Accession Numbers

Genbank: NM_009539; MGI: 99613

 

Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R5051 (G1)
Quality Score69
Status Validated
Chromosome1
Chromosomal Location36761798-36782818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36781451 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 576 (I576V)
Ref Sequence ENSEMBL: ENSMUSP00000027291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027291]
Predicted Effect probably benign
Transcript: ENSMUST00000027291
AA Change: I576V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: I576V

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190128
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,691,986 N313K possibly damaging Het
5730522E02Rik G A 11: 25,768,990 T52I unknown Het
Alms1 C T 6: 85,627,934 Q2189* probably null Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Ap3d1 T G 10: 80,719,199 T431P probably damaging Het
Arnt A G 3: 95,470,337 T125A probably benign Het
Atp10a TGTCCGTC TGTC 7: 58,740,246 probably null Het
Bscl2 A T 19: 8,845,279 R195* probably null Het
Ccdc146 C T 5: 21,303,083 V656I possibly damaging Het
Ccr4 T C 9: 114,492,646 Y117C probably damaging Het
Cd55 T A 1: 130,448,348 D355V probably damaging Het
Cntn6 T A 6: 104,772,597 I259N probably damaging Het
Cspg4 A G 9: 56,885,736 I252V possibly damaging Het
Dmbt1 T C 7: 131,094,742 V895A probably benign Het
Ect2 A G 3: 27,102,486 V806A probably benign Het
Gm14486 T C 2: 30,658,877 noncoding transcript Het
Grin2b T C 6: 135,779,395 N444S possibly damaging Het
Heatr5b T C 17: 78,795,274 D1225G probably damaging Het
Il1rl2 G A 1: 40,343,094 V189I probably benign Het
Kif1a G A 1: 93,076,154 A202V probably null Het
Ltbr T A 6: 125,312,770 T154S probably damaging Het
Mrgpra6 C T 7: 47,185,942 V244I probably benign Het
Myo15 G A 11: 60,487,425 probably null Het
Ndufs1 A G 1: 63,164,947 probably null Het
Nectin3 A T 16: 46,448,550 N496K possibly damaging Het
Nkd2 A G 13: 73,825,076 V147A probably benign Het
Nlrp3 G C 11: 59,566,199 R1013P probably benign Het
Olfr1280 T A 2: 111,316,254 Y258* probably null Het
Olfr1423 C A 19: 12,035,924 V273F possibly damaging Het
Pdk2 T C 11: 95,028,772 S263G probably benign Het
Pla2g4e T A 2: 120,174,304 I520F probably damaging Het
Plat A G 8: 22,773,672 T196A probably benign Het
Podn T A 4: 108,014,846 D400V probably benign Het
Poteg T C 8: 27,453,329 V147A possibly damaging Het
Prkar2a A G 9: 108,745,491 N315D probably benign Het
Rac2 A G 15: 78,564,934 I13T possibly damaging Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Supv3l1 A C 10: 62,443,417 I240S probably damaging Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Tead4 A C 6: 128,294,299 probably benign Het
Tex10 G A 4: 48,460,019 A444V possibly damaging Het
Tgds A T 14: 118,128,227 I73K probably damaging Het
Tmem117 C A 15: 94,714,913 T110K probably damaging Het
Trim30a T A 7: 104,411,706 probably benign Het
Unc80 C T 1: 66,509,477 T636I probably damaging Het
Wisp3 A G 10: 39,155,156 F124L probably benign Het
Ybey G A 10: 76,468,339 R10W probably damaging Het
Zfp64 T C 2: 168,926,384 D436G probably damaging Het
Other mutations in Zap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36781149 missense probably damaging 1.00
murdock APN 1 36779704 missense possibly damaging 0.95
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 unclassified probably benign
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
trebia UTSW 1 36781025 missense probably damaging 1.00
wanna UTSW 1 36770983 missense probably damaging 1.00
wanna2 UTSW 1 36781412 missense probably damaging 1.00
wanna3 UTSW 1 36778218 missense probably damaging 0.99
wanna4 UTSW 1 36781365 missense probably damaging 1.00
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36779284 missense probably damaging 1.00
R0701:Zap70 UTSW 1 36781177 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36770955 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3689:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3690:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site probably benign
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36779009 intron probably benign
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
R6694:Zap70 UTSW 1 36782517 missense probably damaging 1.00
R6825:Zap70 UTSW 1 36778390 missense probably damaging 1.00
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.03
Predicted Primers PCR Primer
(F):5'- CAGTGACGTCTGGAGCTATG -3'
(R):5'- AGTGTGTTGGGAAGCCAAGC -3'

Sequencing Primer
(F):5'- GCCTTCTCCTATGGCCAGAAG -3'
(R):5'- TTGGGAAGCCAAGCACAGATG -3'
Posted OnFeb 13, 2017