Incidental Mutation 'R5096:Gm10715'
ID455753
Institutional Source Beutler Lab
Gene Symbol Gm10715
Ensembl Gene ENSMUSG00000096201
Gene Namepredicted gene 10715
Synonyms
MMRRC Submission 042685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5096 (G1)
Quality Score28
Status Validated
Chromosome9
Chromosomal Location3036877-3038316 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 3038157 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000155807] [ENSMUST00000177969] [ENSMUST00000178641] [ENSMUST00000179839]
Predicted Effect probably benign
Transcript: ENSMUST00000155807
SMART Domains Protein: ENSMUSP00000136448
Gene: ENSMUSG00000096201

DomainStartEndE-ValueType
internal_repeat_1 1 48 2.67e-7 PROSPERO
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 165 2.67e-7 PROSPERO
transmembrane domain 186 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177969
SMART Domains Protein: ENSMUSP00000137129
Gene: ENSMUSG00000096201

DomainStartEndE-ValueType
internal_repeat_1 1 49 2.44e-6 PROSPERO
transmembrane domain 69 91 N/A INTRINSIC
internal_repeat_1 117 185 2.44e-6 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178641
SMART Domains Protein: ENSMUSP00000135988
Gene: ENSMUSG00000096736

DomainStartEndE-ValueType
internal_repeat_1 1 49 1.86e-5 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 185 1.86e-5 PROSPERO
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179839
SMART Domains Protein: ENSMUSP00000136837
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 46 1.07e-7 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 182 1.07e-7 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195989
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 95% (61/64)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,679,222 probably benign Het
Adar T A 3: 89,747,291 *728C probably null Het
Ap3b1 A G 13: 94,479,849 R753G unknown Het
Atp9b C T 18: 80,762,184 V720I probably benign Het
AY358078 A C 14: 51,826,118 D407A probably benign Het
Ccdc185 A G 1: 182,748,789 S112P possibly damaging Het
Cir1 A G 2: 73,303,761 S155P probably damaging Het
Colq C T 14: 31,552,954 E76K possibly damaging Het
Cthrc1 T A 15: 39,084,420 I104N probably damaging Het
D930020B18Rik A T 10: 121,667,804 I92L probably benign Het
Eif3i C T 4: 129,600,444 E21K probably damaging Het
Fam114a1 T A 5: 64,979,891 M59K probably benign Het
Fam163b A G 2: 27,112,749 S79P probably benign Het
Fam181b T G 7: 93,081,245 probably benign Het
Fsip2 G A 2: 82,991,116 S5731N probably benign Het
Fzd9 C T 5: 135,249,859 V391I probably damaging Het
Gbp5 A G 3: 142,501,361 D97G probably damaging Het
Grhl1 A T 12: 24,603,050 K418M probably damaging Het
H2-Q4 T A 17: 35,379,713 probably benign Het
Hmcn1 C A 1: 150,610,669 A4329S probably damaging Het
Hspa8 T C 9: 40,802,901 probably benign Het
Ica1l T C 1: 60,028,154 T26A possibly damaging Het
Ifi209 T A 1: 173,644,734 N380K probably benign Het
Inpp5e G T 2: 26,399,525 N482K probably damaging Het
Iqsec3 C T 6: 121,386,698 V866M probably damaging Het
Kbtbd2 A G 6: 56,779,275 V492A probably benign Het
Kcnb2 A G 1: 15,710,844 R647G probably benign Het
Lcmt1 T G 7: 123,401,468 V75G probably damaging Het
Lrp4 A G 2: 91,485,792 I752V possibly damaging Het
Mmp17 C A 5: 129,605,563 P422Q probably damaging Het
Myo3a A T 2: 22,574,242 H165L probably benign Het
Nos3 C T 5: 24,371,957 T494I probably damaging Het
Olfr1184 C T 2: 88,487,302 T190I possibly damaging Het
Olfr356 T C 2: 36,937,803 V228A possibly damaging Het
Olfr52 A G 2: 86,181,932 Y60H probably damaging Het
Olfr638 T C 7: 104,003,460 Y68H probably benign Het
Pkn2 A C 3: 142,839,331 V27G probably damaging Het
Scube2 T C 7: 109,799,244 probably benign Het
Skint7 A G 4: 111,981,955 I149V probably damaging Het
Smc4 T A 3: 69,021,279 I412K probably damaging Het
Snx19 T A 9: 30,428,786 C407S probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Sytl2 T A 7: 90,376,082 I426N possibly damaging Het
Tbce A T 13: 14,029,405 probably benign Het
Tdpoz2 T C 3: 93,652,512 E51G possibly damaging Het
Tmem221 A G 8: 71,558,709 L34P probably damaging Het
Tmem92 T C 11: 94,779,036 T90A probably benign Het
Tpr A G 1: 150,446,202 D42G probably damaging Het
Wt1 A G 2: 105,143,125 T237A probably damaging Het
Other mutations in Gm10715
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02799:Gm10715 UTSW 9 3038062 unclassified probably benign
IGL02802:Gm10715 UTSW 9 3038062 unclassified probably benign
R4766:Gm10715 UTSW 9 3038073 unclassified probably benign
R4840:Gm10715 UTSW 9 3038062 unclassified probably benign
R4998:Gm10715 UTSW 9 3038073 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGGTCCTACAGTGTGCATTTC -3'
(R):5'- TGATGACTGACTGCCCTACTG -3'

Sequencing Primer
(F):5'- ACAGTGTGCATTTCTCATTTTTCACG -3'
(R):5'- GTCCACTGTAATACCTGGAATATGGC -3'
Posted On2017-02-13