Incidental Mutation 'R4965:Fkbp8'
ID455863
Institutional Source Beutler Lab
Gene Symbol Fkbp8
Ensembl Gene ENSMUSG00000019428
Gene NameFK506 binding protein 8
Synonyms38kDa, Fkbp38
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4965 (G1)
Quality Score199
Status Not validated
Chromosome8
Chromosomal Location70527724-70535328 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 70531523 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075491] [ENSMUST00000117580] [ENSMUST00000119353] [ENSMUST00000119425] [ENSMUST00000119698] [ENSMUST00000132867] [ENSMUST00000134893] [ENSMUST00000138260]
Predicted Effect probably benign
Transcript: ENSMUST00000075491
AA Change: R175G

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074935
Gene: ENSMUSG00000019428
AA Change: R175G

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
Pfam:FKBP_C 103 192 1.4e-16 PFAM
Blast:TPR 212 245 2e-12 BLAST
low complexity region 253 259 N/A INTRINSIC
Pfam:TPR_1 263 296 5.4e-7 PFAM
Pfam:TPR_2 263 296 3.8e-5 PFAM
Pfam:TPR_16 267 331 3e-11 PFAM
Pfam:TPR_9 270 344 1.3e-7 PFAM
Pfam:TPR_19 273 340 1.6e-8 PFAM
Pfam:TPR_1 297 330 5.4e-8 PFAM
Pfam:TPR_2 297 330 1.3e-7 PFAM
Pfam:TPR_8 297 330 9e-7 PFAM
Pfam:TPR_14 297 340 2.1e-7 PFAM
transmembrane domain 381 400 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117580
SMART Domains Protein: ENSMUSP00000112561
Gene: ENSMUSG00000055553

DomainStartEndE-ValueType
Pfam:KxDL 12 99 5.1e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119353
SMART Domains Protein: ENSMUSP00000112527
Gene: ENSMUSG00000019428

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
Pfam:FKBP_C 103 191 1.3e-15 PFAM
Pfam:TPR_11 209 293 3.4e-9 PFAM
Pfam:TPR_1 262 295 6.5e-7 PFAM
Pfam:TPR_2 262 295 3.9e-5 PFAM
Pfam:TPR_16 266 330 1.4e-11 PFAM
Pfam:TPR_9 269 343 1.5e-7 PFAM
Pfam:TPR_19 272 339 8.6e-9 PFAM
Pfam:TPR_11 294 358 2.6e-9 PFAM
Pfam:TPR_1 296 329 6.6e-8 PFAM
Pfam:TPR_2 296 329 1.3e-7 PFAM
Pfam:TPR_8 296 330 5.5e-7 PFAM
transmembrane domain 380 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119425
SMART Domains Protein: ENSMUSP00000113528
Gene: ENSMUSG00000019428

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119698
AA Change: R175G

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114069
Gene: ENSMUSG00000019428
AA Change: R175G

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
Pfam:FKBP_C 103 192 6.4e-16 PFAM
Pfam:TPR_11 210 294 3.4e-9 PFAM
Pfam:TPR_1 263 296 6.5e-7 PFAM
Pfam:TPR_2 263 296 3.9e-5 PFAM
Pfam:TPR_16 267 331 1.4e-11 PFAM
Pfam:TPR_9 270 344 1.5e-7 PFAM
Pfam:TPR_19 273 340 8.6e-9 PFAM
Pfam:TPR_11 295 359 2.6e-9 PFAM
Pfam:TPR_1 297 330 6.6e-8 PFAM
Pfam:TPR_2 297 330 1.3e-7 PFAM
Pfam:TPR_8 297 331 5.6e-7 PFAM
transmembrane domain 381 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128513
Predicted Effect probably benign
Transcript: ENSMUST00000132867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134299
Predicted Effect probably benign
Transcript: ENSMUST00000134893
Predicted Effect probably benign
Transcript: ENSMUST00000138260
SMART Domains Protein: ENSMUSP00000123438
Gene: ENSMUSG00000055553

DomainStartEndE-ValueType
Pfam:KxDL 12 99 9.2e-40 PFAM
UBQ 105 176 2.14e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144766
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, ventralization of neural cell fates, caudal neural tube dilation, and small eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,672 T1541A probably benign Het
2810474O19Rik G T 6: 149,328,398 G981* probably null Het
4931423N10Rik C A 2: 23,245,115 T312K probably benign Het
9530002B09Rik T C 4: 122,700,492 M59T probably benign Het
Adam18 C T 8: 24,641,811 C428Y probably damaging Het
Adcy5 A G 16: 35,278,502 E700G possibly damaging Het
Adprh G T 16: 38,445,780 Y333* probably null Het
Agfg2 C A 5: 137,667,177 probably null Het
Akip1 A T 7: 109,711,754 E167V probably damaging Het
Akr1c21 A T 13: 4,580,305 Q199L probably damaging Het
Aldh9a1 C A 1: 167,365,789 A455E probably damaging Het
Amph G A 13: 19,137,699 S520N probably benign Het
Ankrd52 A G 10: 128,390,507 D1006G probably benign Het
Ap5z1 A C 5: 142,467,676 Q133P probably damaging Het
Babam1 C T 8: 71,404,388 A331V possibly damaging Het
Btc T C 5: 91,362,301 probably null Het
Cacna2d3 A G 14: 28,982,332 F831L probably benign Het
Cadm3 G A 1: 173,337,097 P372L probably damaging Het
Capn5 A T 7: 98,126,417 M439K probably damaging Het
Carf T C 1: 60,150,637 S639P probably damaging Het
Casp12 C T 9: 5,352,250 R81C probably benign Het
Ces2e G T 8: 104,933,698 R555M probably benign Het
Cfap54 T A 10: 93,066,799 I164F probably benign Het
Cltc C T 11: 86,707,501 V1012I probably damaging Het
Cmya5 G A 13: 93,095,787 T931I possibly damaging Het
Cntn6 A G 6: 104,774,474 I364V probably damaging Het
Cntnap1 A T 11: 101,177,425 I59F possibly damaging Het
Cop1 T C 1: 159,239,597 M80T probably damaging Het
Cplx2 A G 13: 54,379,647 S115G possibly damaging Het
Crtac1 A G 19: 42,318,740 Y195H probably damaging Het
Csn1s2a A C 5: 87,781,838 S99R possibly damaging Het
Csn1s2b T A 5: 87,813,961 D41E possibly damaging Het
Cul9 C T 17: 46,538,525 D565N probably damaging Het
Cux1 A T 5: 136,311,556 N625K possibly damaging Het
Cyp2c37 A T 19: 40,011,762 M443L possibly damaging Het
Cyp2s1 G A 7: 25,809,285 T244I possibly damaging Het
Dgkh C T 14: 78,624,421 V135M probably damaging Het
Dtl T C 1: 191,546,565 E395G possibly damaging Het
Dyrk1a G T 16: 94,691,995 G658* probably null Het
Erlin2 T C 8: 27,029,595 F117S probably damaging Het
Fras1 T C 5: 96,726,580 F2288S possibly damaging Het
Frmd3 A G 4: 74,153,600 T240A probably damaging Het
H2-D1 A G 17: 35,263,905 Y137C probably damaging Het
Helz2 A G 2: 181,240,916 V28A possibly damaging Het
Hydin A G 8: 110,398,095 I579V probably benign Het
Il6 A T 5: 30,013,493 Y29F possibly damaging Het
Ildr2 A G 1: 166,307,840 D368G probably damaging Het
Junb T A 8: 84,978,159 I91F probably damaging Het
Kat2a C A 11: 100,712,203 probably benign Het
Kat2a A T 11: 100,712,204 probably benign Het
Kcnh5 T A 12: 74,965,151 T665S probably benign Het
Kdm1b A T 13: 47,074,367 D608V probably damaging Het
Krcc1 A G 6: 71,284,637 K218E probably damaging Het
Krt8 C T 15: 101,996,951 V488M probably benign Het
Lzts1 C T 8: 69,138,762 A245T probably benign Het
Mcm6 T A 1: 128,359,486 Q27L probably damaging Het
Mfsd4b3 G T 10: 39,947,690 Y191* probably null Het
Mgme1 C T 2: 144,276,404 Q199* probably null Het
Mgme1 T C 2: 144,279,620 L332P probably benign Het
Morc3 G T 16: 93,860,587 E25* probably null Het
Mroh7 G A 4: 106,690,987 A1098V possibly damaging Het
Mtrf1 G A 14: 79,406,587 R174H probably benign Het
Mybpc3 G A 2: 91,119,247 G45D possibly damaging Het
Mycbpap A T 11: 94,504,938 N733K probably damaging Het
N4bp1 T C 8: 86,851,686 I684V possibly damaging Het
Nav2 A T 7: 49,552,877 R1470* probably null Het
Ndufa9 A T 6: 126,822,063 S364T probably benign Het
Nipal4 C A 11: 46,162,010 A43S possibly damaging Het
Nlrp1a T A 11: 71,092,315 Y1275F possibly damaging Het
Nova1 A T 12: 46,720,835 L8* probably null Het
Odam G T 5: 87,890,108 G181* probably null Het
Olfr1111 T A 2: 87,150,659 M1L possibly damaging Het
Olfr1297 T C 2: 111,621,534 D180G probably damaging Het
Olfr15 T C 16: 3,839,570 L199P probably damaging Het
Olfr186 A T 16: 59,027,333 D191E probably damaging Het
Olfr283 T C 15: 98,379,149 probably benign Het
Olfr33 A T 7: 102,713,495 I306N probably damaging Het
Olfr723 C T 14: 49,928,897 V216I probably benign Het
Optn T A 2: 5,021,379 Q576L probably benign Het
Patl2 G T 2: 122,128,848 S45* probably null Het
Pde2a G A 7: 101,502,933 G349E probably benign Het
Pdlim2 T A 14: 70,168,015 probably benign Het
Per1 T C 11: 69,104,401 V653A probably benign Het
Phlda2 A G 7: 143,502,268 S75P probably damaging Het
Poldip3 A T 15: 83,137,505 M167K possibly damaging Het
Prpf38a T C 4: 108,579,081 I12V probably benign Het
Prrc1 G A 18: 57,374,550 V259I possibly damaging Het
Ptges3l A T 11: 101,424,622 M1K probably null Het
Rdh5 A G 10: 128,913,784 Y296H probably damaging Het
Rnf2 T A 1: 151,473,217 K51* probably null Het
Rpusd3 C A 6: 113,416,848 R215L probably benign Het
Rsph4a A T 10: 33,909,240 E382D probably damaging Het
S1pr2 G A 9: 20,968,449 Q28* probably null Het
Sesn1 A T 10: 41,895,009 I179F probably damaging Het
Setd3 T A 12: 108,113,371 E291V probably benign Het
Shc1 G T 3: 89,426,996 R323L probably damaging Het
Slc22a5 T C 11: 53,891,526 D5G possibly damaging Het
Slc6a19 T C 13: 73,700,558 K26E probably benign Het
Slc9a3 A G 13: 74,164,293 N670D possibly damaging Het
Spata19 A T 9: 27,400,465 I127L probably benign Het
Speg G T 1: 75,427,703 V2751L probably damaging Het
Sptbn2 A G 19: 4,729,309 D298G probably benign Het
Srm T C 4: 148,594,183 V289A possibly damaging Het
Stip1 C T 19: 7,035,570 A49T probably benign Het
Tas2r118 C A 6: 23,969,628 V145F probably benign Het
Tbc1d12 A T 19: 38,865,725 K284* probably null Het
Tfcp2 T C 15: 100,525,650 H125R probably damaging Het
Tfdp1 T C 8: 13,373,073 V206A probably damaging Het
Tgtp2 A G 11: 49,059,410 W112R probably damaging Het
Tmem71 T G 15: 66,538,861 M221L probably benign Het
Tpcn1 T C 5: 120,547,487 N436S possibly damaging Het
Usp4 C T 9: 108,362,620 L183F probably damaging Het
Vmn2r55 A T 7: 12,670,551 N308K possibly damaging Het
Zfp106 T A 2: 120,533,919 D669V probably damaging Het
Zfp108 A T 7: 24,260,148 I55L probably benign Het
Zfp512b A T 2: 181,586,338 S8R probably damaging Het
Zfp827 T C 8: 79,061,281 S359P probably benign Het
Other mutations in Fkbp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Fkbp8 APN 8 70534561 missense probably damaging 1.00
IGL01832:Fkbp8 APN 8 70531545 missense probably benign 0.24
R0738:Fkbp8 UTSW 8 70529670 missense probably damaging 1.00
R1631:Fkbp8 UTSW 8 70531632 missense probably damaging 1.00
R1845:Fkbp8 UTSW 8 70531035 unclassified probably null
R3951:Fkbp8 UTSW 8 70532661 missense probably damaging 1.00
R3953:Fkbp8 UTSW 8 70534867 missense probably damaging 0.97
R3956:Fkbp8 UTSW 8 70534867 missense probably damaging 0.97
R3957:Fkbp8 UTSW 8 70534867 missense probably damaging 0.97
R6655:Fkbp8 UTSW 8 70532670 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCCCGTTTCACAGAAAGG -3'
(R):5'- CCAGGTCATAGGAATTGGCG -3'

Sequencing Primer
(F):5'- TTAGGCTGGCCAGGTCACAG -3'
(R):5'- TCATAGGAATTGGCGGCCAG -3'
Posted On2017-02-14