Incidental Mutation 'IGL03097:Hjurp'
ID456019
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene NameHolliday junction recognition protein
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #IGL03097 (G1)
Quality Score198
Status Validated
Chromosome1
Chromosomal Location88262471-88277633 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) TGGG to TTGCGGG at 88266280 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
Predicted Effect probably benign
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128532
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148384
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 90% (46/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adcy9 T C 16: 4,418,066 T257A possibly damaging Het
Ahnak A G 19: 9,002,387 D345G probably benign Het
Ak5 A G 3: 152,660,514 probably null Het
Akap3 A G 6: 126,866,416 K666R probably damaging Het
Alpk3 A G 7: 81,093,909 N1158S probably benign Het
Atp23 A T 10: 126,887,687 V182E probably damaging Het
Atp4a A G 7: 30,723,037 D898G probably benign Het
Bnip3 T C 7: 138,894,479 N140S probably damaging Het
Bptf T C 11: 107,077,680 Y1059C probably damaging Het
Cacna1h A T 17: 25,391,144 I796N probably damaging Het
Ccnb2 A G 9: 70,409,396 probably benign Het
Cd3g T A 9: 44,970,763 D165V probably damaging Het
Cfap70 T C 14: 20,448,608 T4A probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Cntn4 C T 6: 106,353,712 T97M probably benign Het
Crb1 CG C 1: 139,237,086 probably null Het
Crim1 C T 17: 78,367,798 T812I probably benign Het
Csmd1 G T 8: 15,945,127 T2636K probably damaging Het
Cyp39a1 T A 17: 43,683,050 Y200* probably null Het
Dlg4 T G 11: 70,042,202 I478S probably damaging Het
Dsc3 A T 18: 19,974,048 N505K probably benign Het
Efhc1 T C 1: 20,972,825 W323R probably damaging Het
Ehhadh T A 16: 21,762,770 I491L probably benign Het
Ggt6 T G 11: 72,436,813 H148Q possibly damaging Het
Gstm3 T C 3: 107,968,801 D25G probably benign Het
Gtf2h3 G A 5: 124,602,168 probably benign Het
Hnf4g A C 3: 3,651,614 E281A probably damaging Het
Impg1 T G 9: 80,379,952 E404A possibly damaging Het
Kcna2 T C 3: 107,105,399 V432A probably benign Het
Map3k2 T G 18: 32,200,017 D81E probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mmp9 T A 2: 164,950,806 probably null Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Ms4a1 G T 19: 11,253,192 T215N probably benign Het
Pam16 T C 16: 4,616,594 I111V probably benign Het
Pde6c A G 19: 38,178,271 T720A probably damaging Het
Pgap2 T C 7: 102,236,227 L100P probably damaging Het
Ppl T A 16: 5,096,726 S686C probably damaging Het
Rnls A G 19: 33,138,279 probably benign Het
Robo3 A C 9: 37,422,528 probably null Het
Rptn G A 3: 93,397,373 G671D probably damaging Het
Slc6a21 C T 7: 45,288,168 Q628* probably null Het
Smg6 T G 11: 74,932,426 I708S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Thap1 C G 8: 26,162,470 P79A probably benign Het
Vmn1r202 G A 13: 22,501,470 T259I probably benign Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88270269 missense probably benign 0.04
IGL03099:Hjurp APN 1 88266289 missense probably benign 0.09
IGL03098:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88266280 utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266046 missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266561 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266616 missense probably benign 0.04
PIT4378001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R0053:Hjurp UTSW 1 88277215 splice site probably benign
R0371:Hjurp UTSW 1 88277368 splice site probably benign
R0442:Hjurp UTSW 1 88266524 nonsense probably null
R0762:Hjurp UTSW 1 88277215 splice site probably benign
R0928:Hjurp UTSW 1 88266524 nonsense probably null
R1333:Hjurp UTSW 1 88266046 missense probably damaging 0.98
R1342:Hjurp UTSW 1 88277368 splice site probably benign
R1364:Hjurp UTSW 1 88266525 frame shift probably null
R1496:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88266121 missense probably benign 0.03
R1905:Hjurp UTSW 1 88266616 missense probably benign 0.04
R1965:Hjurp UTSW 1 88266524 nonsense probably null
R1992:Hjurp UTSW 1 88266524 nonsense probably null
R2002:Hjurp UTSW 1 88266524 nonsense probably null
R2023:Hjurp UTSW 1 88266524 nonsense probably null
R2024:Hjurp UTSW 1 88266524 nonsense probably null
R2332:Hjurp UTSW 1 88277215 splice site probably benign
R2420:Hjurp UTSW 1 88266524 nonsense probably null
R2422:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R2869:Hjurp UTSW 1 88266524 nonsense probably null
R2870:Hjurp UTSW 1 88266524 nonsense probably null
R2871:Hjurp UTSW 1 88266524 nonsense probably null
R2872:Hjurp UTSW 1 88266524 nonsense probably null
R3019:Hjurp UTSW 1 88266524 nonsense probably null
R3021:Hjurp UTSW 1 88266524 nonsense probably null
R3150:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R3411:Hjurp UTSW 1 88266524 nonsense probably null
R3552:Hjurp UTSW 1 88266524 nonsense probably null
R3704:Hjurp UTSW 1 88277215 splice site probably benign
R3730:Hjurp UTSW 1 88266524 nonsense probably null
R3733:Hjurp UTSW 1 88266524 nonsense probably null
R3764:Hjurp UTSW 1 88266524 nonsense probably null
R3799:Hjurp UTSW 1 88277215 splice site probably benign
R3819:Hjurp UTSW 1 88277215 splice site probably benign
R3857:Hjurp UTSW 1 88266524 nonsense probably null
R3930:Hjurp UTSW 1 88266524 nonsense probably null
R3952:Hjurp UTSW 1 88277215 splice site probably benign
R4090:Hjurp UTSW 1 88277215 splice site probably benign
R4159:Hjurp UTSW 1 88277215 splice site probably benign
R4207:Hjurp UTSW 1 88277215 splice site probably benign
R4322:Hjurp UTSW 1 88277215 splice site probably benign
R4391:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4392:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4397:Hjurp UTSW 1 88266524 nonsense probably null
R4700:Hjurp UTSW 1 88266524 nonsense probably null
R4808:Hjurp UTSW 1 88277215 splice site probably benign
R4900:Hjurp UTSW 1 88266524 nonsense probably null
R4901:Hjurp UTSW 1 88266524 nonsense probably null
R5023:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88266524 nonsense probably null
R5123:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88266524 nonsense probably null
R5300:Hjurp UTSW 1 88266524 nonsense probably null
R5318:Hjurp UTSW 1 88266524 nonsense probably null
R5370:Hjurp UTSW 1 88266524 nonsense probably null
R5410:Hjurp UTSW 1 88266524 nonsense probably null
R5445:Hjurp UTSW 1 88266316 missense probably benign 0.43
R5457:Hjurp UTSW 1 88266525 frame shift probably null
R5497:Hjurp UTSW 1 88266320 missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88266524 nonsense probably null
R5561:Hjurp UTSW 1 88266524 nonsense probably null
R5615:Hjurp UTSW 1 88266524 nonsense probably null
R5661:Hjurp UTSW 1 88277215 splice site probably benign
R5722:Hjurp UTSW 1 88266524 nonsense probably null
R6087:Hjurp UTSW 1 88266524 nonsense probably null
R6089:Hjurp UTSW 1 88266524 nonsense probably null
R6090:Hjurp UTSW 1 88266524 nonsense probably null
R6125:Hjurp UTSW 1 88266524 nonsense probably null
R6175:Hjurp UTSW 1 88266524 nonsense probably null
R6362:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88266524 nonsense probably null
R7016:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R7016:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7045:Hjurp UTSW 1 88266278 utr 3 prime probably benign
V5622:Hjurp UTSW 1 88277525 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCTTCTGCGGCATCATC -3'
(R):5'- TGACCTTTGCAATGTGACAATCAG -3'

Sequencing Primer
(F):5'- CTTCTGCGGCATCATCTGGAG -3'
(R):5'- GCAATGTGACAATCAGCGATTTG -3'
Posted On2017-02-15