Incidental Mutation 'R5885:Fcgr3'
ID456022
Institutional Source Beutler Lab
Gene Symbol Fcgr3
Ensembl Gene ENSMUSG00000059498
Gene NameFc receptor, IgG, low affinity III
SynonymsCD16, FcgammaRIII, Fcg receptor III
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5885 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171051174-171064935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171057711 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 115 (V115A)
Ref Sequence ENSEMBL: ENSMUSP00000131938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164044] [ENSMUST00000164179] [ENSMUST00000169017]
Predicted Effect probably damaging
Transcript: ENSMUST00000164044
AA Change: V115A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131938
Gene: ENSMUSG00000059498
AA Change: V115A

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
IG 47 120 1.2e-1 SMART
IG 128 206 1.24e-8 SMART
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164179
SMART Domains Protein: ENSMUSP00000133039
Gene: ENSMUSG00000059498

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
PDB:3WJL|C 35 74 6e-11 PDB
SCOP:d1f2qa1 39 74 8e-7 SMART
Blast:IG 46 74 4e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168817
Predicted Effect possibly damaging
Transcript: ENSMUST00000169017
AA Change: V114A

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131836
Gene: ENSMUSG00000059498
AA Change: V114A

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
IG 46 119 1.2e-1 SMART
IG 127 205 1.24e-8 SMART
transmembrane domain 218 240 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one member of a family of immunoglobulin Fc receptor genes found on the surface of many immune response cells. The protein encoded by this gene is a cell surface receptor found on phagocytic cells such as macrophages and neutrophils, and is involved in the process of phagocytosis and clearing of immune complexes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a targeted null mutation lack IgG-mediated mast cell degranulation and have impaired IgG-dependent anaphylaxis and Arthus reactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Fcgr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Fcgr3 APN 1 171059280 missense probably damaging 1.00
PIT4696001:Fcgr3 UTSW 1 171057750 missense probably damaging 1.00
R1722:Fcgr3 UTSW 1 171054119 missense possibly damaging 0.89
R3734:Fcgr3 UTSW 1 171057874 missense probably benign 0.04
R4207:Fcgr3 UTSW 1 171054075 missense probably benign 0.29
R7237:Fcgr3 UTSW 1 171059301 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGACTGAGGCCAATACAG -3'
(R):5'- TCCAGGTGCTCAAGGAAGAC -3'

Sequencing Primer
(F):5'- CGCAAGACTACACAGAGTAAGCG -3'
(R):5'- TGCTCAAGGAAGACATGGTGAC -3'
Posted On2017-02-15