Incidental Mutation 'R5885:Psg27'
ID456037
Institutional Source Beutler Lab
Gene Symbol Psg27
Ensembl Gene ENSMUSG00000070797
Gene Namepregnancy-specific glycoprotein 27
SynonymsEG545925, cea15
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.019) question?
Stock #R5885 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location18556514-18567305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18561786 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 245 (N245Y)
Ref Sequence ENSEMBL: ENSMUSP00000092388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094794]
Predicted Effect probably damaging
Transcript: ENSMUST00000094794
AA Change: N245Y

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092388
Gene: ENSMUSG00000070797
AA Change: N245Y

DomainStartEndE-ValueType
IG 39 140 4.13e-5 SMART
IG 159 260 5.89e-1 SMART
IG 279 380 1.39e-2 SMART
IGc2 396 460 3.62e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Psg27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Psg27 APN 7 18561804 missense probably damaging 1.00
IGL00417:Psg27 APN 7 18561917 missense probably benign 0.22
IGL01344:Psg27 APN 7 18560417 missense probably damaging 1.00
IGL01781:Psg27 APN 7 18565064 missense probably damaging 1.00
IGL02547:Psg27 APN 7 18560628 missense probably benign
IGL02926:Psg27 APN 7 18557129 missense probably damaging 0.99
IGL03074:Psg27 APN 7 18560529 missense probably benign 0.02
IGL03237:Psg27 APN 7 18560492 missense probably benign 0.00
IGL02796:Psg27 UTSW 7 18561950 missense probably benign 0.08
R0437:Psg27 UTSW 7 18560711 splice site probably benign
R0604:Psg27 UTSW 7 18557072 missense probably damaging 0.98
R1163:Psg27 UTSW 7 18565309 missense probably damaging 0.99
R2072:Psg27 UTSW 7 18560417 missense probably damaging 1.00
R2072:Psg27 UTSW 7 18565009 missense probably benign 0.16
R2073:Psg27 UTSW 7 18560417 missense probably damaging 1.00
R2074:Psg27 UTSW 7 18560417 missense probably damaging 1.00
R2081:Psg27 UTSW 7 18556958 missense probably damaging 1.00
R2206:Psg27 UTSW 7 18567111 nonsense probably null
R2866:Psg27 UTSW 7 18561893 missense probably benign
R3783:Psg27 UTSW 7 18560354 missense probably damaging 1.00
R3784:Psg27 UTSW 7 18560354 missense probably damaging 1.00
R4463:Psg27 UTSW 7 18557085 missense possibly damaging 0.46
R5312:Psg27 UTSW 7 18557033 missense probably benign 0.43
R6087:Psg27 UTSW 7 18556944 missense probably benign 0.05
X0064:Psg27 UTSW 7 18561795 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGTGTCCTGCATAGAGTAGTC -3'
(R):5'- CCGTGTTCACAATCTTCCAGAG -3'

Sequencing Primer
(F):5'- GTGTCCTGCATAGAGTAGTCAAACC -3'
(R):5'- GTTCACAATCTTCCAGAGTATCTTC -3'
Posted On2017-02-15