Incidental Mutation 'R5885:Xkr6'
ID456055
Institutional Source Beutler Lab
Gene Symbol Xkr6
Ensembl Gene ENSMUSG00000035067
Gene NameX-linked Kx blood group related 6
Synonyms
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5885 (G1)
Quality Score182
Status Not validated
Chromosome14
Chromosomal Location63606503-63820809 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63606911 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 128 (W128R)
Ref Sequence ENSEMBL: ENSMUSP00000113708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119973]
Predicted Effect probably damaging
Transcript: ENSMUST00000119973
AA Change: W128R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113708
Gene: ENSMUSG00000035067
AA Change: W128R

DomainStartEndE-ValueType
low complexity region 25 51 N/A INTRINSIC
Pfam:XK-related 127 498 1.1e-125 PFAM
low complexity region 627 638 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137259
Predicted Effect unknown
Transcript: ENSMUST00000176510
AA Change: W79R
SMART Domains Protein: ENSMUSP00000134975
Gene: ENSMUSG00000035067
AA Change: W79R

DomainStartEndE-ValueType
Pfam:XK-related 79 207 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177500
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Neurl2 T C 2: 164,832,891 T184A probably damaging Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Other mutations in Xkr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Xkr6 APN 14 63819215 missense probably damaging 0.96
IGL01419:Xkr6 APN 14 63818876 missense probably benign 0.39
IGL01450:Xkr6 APN 14 63798215 missense probably damaging 0.98
IGL02010:Xkr6 APN 14 63819204 missense probably benign 0.39
IGL02352:Xkr6 APN 14 63819707 missense unknown
IGL02359:Xkr6 APN 14 63819707 missense unknown
R0148:Xkr6 UTSW 14 63819549 missense unknown
R0521:Xkr6 UTSW 14 63819422 missense probably benign 0.28
R1555:Xkr6 UTSW 14 63818925 missense unknown
R1619:Xkr6 UTSW 14 63819317 missense probably benign 0.39
R1874:Xkr6 UTSW 14 63798296 missense unknown
R2864:Xkr6 UTSW 14 63819756 missense unknown
R2960:Xkr6 UTSW 14 63607137 missense possibly damaging 0.71
R3014:Xkr6 UTSW 14 63819344 missense unknown
R4888:Xkr6 UTSW 14 63819504 missense unknown
R5019:Xkr6 UTSW 14 63819066 missense unknown
R5193:Xkr6 UTSW 14 63818907 missense possibly damaging 0.92
R5354:Xkr6 UTSW 14 63818904 missense possibly damaging 0.48
R5485:Xkr6 UTSW 14 63819384 missense unknown
R5825:Xkr6 UTSW 14 63819032 missense probably benign 0.39
R6074:Xkr6 UTSW 14 63607070 missense possibly damaging 0.67
R6861:Xkr6 UTSW 14 63819644 missense probably benign 0.39
R7289:Xkr6 UTSW 14 63798299 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAAGATGGCGGCGAAATCC -3'
(R):5'- TGTAGTCCTGCACGAACCAG -3'

Sequencing Primer
(F):5'- AGCTCGCTGCACATCTG -3'
(R):5'- CTGCACGAACCAGCGGAAG -3'
Posted On2017-02-15