Incidental Mutation 'R5887:Prpf8'
ID 456177
Institutional Source Beutler Lab
Gene Symbol Prpf8
Ensembl Gene ENSMUSG00000020850
Gene Name pre-mRNA processing factor 8
Synonyms Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R5887 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 75377642-75400275 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75391734 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1494 (Y1494C)
Ref Sequence ENSEMBL: ENSMUSP00000099568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510]
AlphaFold Q99PV0
Predicted Effect possibly damaging
Transcript: ENSMUST00000018449
AA Change: Y1494C

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: Y1494C

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-84 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 393 801 3.6e-226 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1079 7.1e-49 PFAM
Pfam:U5_2-snRNA_bdg 1208 1343 1.9e-73 PFAM
Pfam:U6-snRNA_bdg 1442 1601 3.7e-97 PFAM
Pfam:PRP8_domainIV 1760 1990 1.5e-132 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102510
AA Change: Y1494C

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: Y1494C

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-90 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 395 801 2.9e-239 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1077 1.5e-51 PFAM
Pfam:U5_2-snRNA_bdg 1210 1343 1.1e-77 PFAM
Pfam:U6-snRNA_bdg 1442 1600 4.2e-97 PFAM
Pfam:PRP8_domainIV 1760 1989 9.8e-134 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,892,124 (GRCm39) Q129* probably null Het
Acad8 A T 9: 26,890,620 (GRCm39) probably null Het
AK157302 T C 13: 21,679,579 (GRCm39) I35T possibly damaging Het
Arfgef3 G T 10: 18,483,413 (GRCm39) S1437* probably null Het
Calcrl A T 2: 84,200,841 (GRCm39) W68R probably damaging Het
Cd200l1 T A 16: 45,238,279 (GRCm39) L178F probably damaging Het
Cd59a A G 2: 103,934,546 (GRCm39) R5G probably damaging Het
Chl1 C T 6: 103,694,565 (GRCm39) A1091V probably benign Het
Copg1 T C 6: 87,879,279 (GRCm39) F442L probably damaging Het
Creld1 T C 6: 113,469,860 (GRCm39) *421Q probably null Het
Crocc2 T A 1: 93,121,838 (GRCm39) H662Q possibly damaging Het
Csf2ra G A 19: 61,215,766 (GRCm39) A13V possibly damaging Het
Cul3 T C 1: 80,254,139 (GRCm39) T546A possibly damaging Het
Dnah8 C T 17: 31,013,691 (GRCm39) P3811S probably damaging Het
Dock6 T A 9: 21,731,690 (GRCm39) H1173L probably damaging Het
Dpysl4 T C 7: 138,676,192 (GRCm39) I328T possibly damaging Het
Dspp G A 5: 104,323,321 (GRCm39) G155R probably damaging Het
Fbxo33 A T 12: 59,251,545 (GRCm39) C57* probably null Het
Frrs1 T A 3: 116,690,399 (GRCm39) V14D probably benign Het
Gm13199 C T 2: 5,867,113 (GRCm39) G96S unknown Het
Gpr155 A T 2: 73,174,062 (GRCm39) C754* probably null Het
Gpr62 A T 9: 106,342,814 (GRCm39) V38E probably damaging Het
Kcnt2 C A 1: 140,353,104 (GRCm39) P271H probably damaging Het
Kpna3 C T 14: 61,640,461 (GRCm39) V34I probably benign Het
Lamb1 C T 12: 31,316,863 (GRCm39) Q71* probably null Het
Lipk T C 19: 34,016,507 (GRCm39) I245T possibly damaging Het
Lrp1b T G 2: 40,711,719 (GRCm39) N3281T possibly damaging Het
Lrp5 A C 19: 3,654,094 (GRCm39) I1111S probably benign Het
Mmrn1 T C 6: 60,964,058 (GRCm39) V1020A probably benign Het
Or4c107 G A 2: 88,789,098 (GRCm39) C96Y possibly damaging Het
Or8b48 G A 9: 38,493,080 (GRCm39) C169Y probably damaging Het
Or8g34 T C 9: 39,372,787 (GRCm39) L17P probably damaging Het
Pcdha7 A T 18: 37,108,960 (GRCm39) T662S probably damaging Het
Pcdhga6 A G 18: 37,841,612 (GRCm39) D444G probably damaging Het
Pkd2 T G 5: 104,646,405 (GRCm39) D737E probably damaging Het
Plcd4 C T 1: 74,590,249 (GRCm39) R161W probably damaging Het
Rad17 A C 13: 100,770,369 (GRCm39) probably null Het
Rbm17 A T 2: 11,590,485 (GRCm39) F390Y probably damaging Het
Rhod A T 19: 4,489,315 (GRCm39) L22Q probably damaging Het
Serpina1f T C 12: 103,656,046 (GRCm39) D394G possibly damaging Het
Serpina1f G A 12: 103,659,890 (GRCm39) Q131* probably null Het
Spocd1 A T 4: 129,842,752 (GRCm39) S56C probably damaging Het
St7l G A 3: 104,782,244 (GRCm39) R207H probably benign Het
Tasor T A 14: 27,188,254 (GRCm39) L900* probably null Het
Tbx18 T C 9: 87,595,566 (GRCm39) D336G possibly damaging Het
Tfg A T 16: 56,514,779 (GRCm39) Y135* probably null Het
Tjp2 A G 19: 24,073,963 (GRCm39) L1108P probably benign Het
Tmem150c C A 5: 100,243,524 (GRCm39) V8L probably benign Het
Ttn A T 2: 76,746,789 (GRCm39) H4753Q probably benign Het
Tyw1 T A 5: 130,354,540 (GRCm39) I589N probably damaging Het
Usp40 C T 1: 87,927,592 (GRCm39) R139Q probably damaging Het
Zgrf1 A G 3: 127,378,414 (GRCm39) Y174C probably damaging Het
Other mutations in Prpf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01376:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01393:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01395:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01554:Prpf8 APN 11 75,386,472 (GRCm39) missense probably damaging 1.00
IGL01560:Prpf8 APN 11 75,381,232 (GRCm39) missense possibly damaging 0.55
IGL01886:Prpf8 APN 11 75,386,570 (GRCm39) missense probably benign 0.32
IGL01946:Prpf8 APN 11 75,390,818 (GRCm39) missense probably damaging 1.00
IGL02022:Prpf8 APN 11 75,392,660 (GRCm39) nonsense probably null
IGL02077:Prpf8 APN 11 75,386,635 (GRCm39) missense probably damaging 0.96
IGL02141:Prpf8 APN 11 75,381,498 (GRCm39) missense possibly damaging 0.68
IGL02455:Prpf8 APN 11 75,400,084 (GRCm39) missense probably benign 0.32
cutter UTSW 11 75,386,252 (GRCm39) splice site probably null
BB009:Prpf8 UTSW 11 75,383,423 (GRCm39) missense possibly damaging 0.92
BB019:Prpf8 UTSW 11 75,383,423 (GRCm39) missense possibly damaging 0.92
PIT4514001:Prpf8 UTSW 11 75,387,181 (GRCm39) missense possibly damaging 0.53
R0254:Prpf8 UTSW 11 75,397,188 (GRCm39) missense possibly damaging 0.93
R0270:Prpf8 UTSW 11 75,396,075 (GRCm39) missense probably damaging 0.99
R0504:Prpf8 UTSW 11 75,392,768 (GRCm39) splice site probably benign
R0573:Prpf8 UTSW 11 75,381,480 (GRCm39) missense probably damaging 1.00
R0613:Prpf8 UTSW 11 75,394,270 (GRCm39) missense probably damaging 1.00
R0893:Prpf8 UTSW 11 75,384,775 (GRCm39) missense probably damaging 1.00
R0967:Prpf8 UTSW 11 75,385,256 (GRCm39) missense probably damaging 1.00
R0975:Prpf8 UTSW 11 75,399,500 (GRCm39) unclassified probably benign
R1123:Prpf8 UTSW 11 75,386,111 (GRCm39) missense probably damaging 1.00
R1183:Prpf8 UTSW 11 75,381,156 (GRCm39) missense possibly damaging 0.95
R1857:Prpf8 UTSW 11 75,386,249 (GRCm39) critical splice donor site probably null
R1901:Prpf8 UTSW 11 75,395,570 (GRCm39) missense probably damaging 0.99
R1950:Prpf8 UTSW 11 75,387,337 (GRCm39) missense possibly damaging 0.72
R2116:Prpf8 UTSW 11 75,378,547 (GRCm39) missense possibly damaging 0.51
R2147:Prpf8 UTSW 11 75,381,357 (GRCm39) missense probably benign
R2185:Prpf8 UTSW 11 75,377,939 (GRCm39) nonsense probably null
R2271:Prpf8 UTSW 11 75,386,189 (GRCm39) missense probably damaging 1.00
R2272:Prpf8 UTSW 11 75,386,189 (GRCm39) missense probably damaging 1.00
R2898:Prpf8 UTSW 11 75,386,860 (GRCm39) missense probably benign 0.00
R3744:Prpf8 UTSW 11 75,397,547 (GRCm39) splice site probably null
R3893:Prpf8 UTSW 11 75,391,083 (GRCm39) missense possibly damaging 0.73
R4400:Prpf8 UTSW 11 75,381,528 (GRCm39) missense possibly damaging 0.63
R4510:Prpf8 UTSW 11 75,382,652 (GRCm39) missense probably damaging 0.96
R4511:Prpf8 UTSW 11 75,382,652 (GRCm39) missense probably damaging 0.96
R4784:Prpf8 UTSW 11 75,383,331 (GRCm39) missense probably damaging 1.00
R5089:Prpf8 UTSW 11 75,400,054 (GRCm39) splice site probably null
R5186:Prpf8 UTSW 11 75,380,609 (GRCm39) missense possibly damaging 0.93
R5215:Prpf8 UTSW 11 75,391,030 (GRCm39) missense probably benign 0.02
R5288:Prpf8 UTSW 11 75,386,625 (GRCm39) missense probably damaging 1.00
R5362:Prpf8 UTSW 11 75,397,236 (GRCm39) missense possibly damaging 0.53
R5384:Prpf8 UTSW 11 75,386,625 (GRCm39) missense probably damaging 1.00
R5386:Prpf8 UTSW 11 75,386,625 (GRCm39) missense probably damaging 1.00
R5423:Prpf8 UTSW 11 75,399,784 (GRCm39) missense probably damaging 1.00
R5472:Prpf8 UTSW 11 75,394,469 (GRCm39) missense possibly damaging 0.89
R5539:Prpf8 UTSW 11 75,394,464 (GRCm39) missense probably benign 0.20
R5620:Prpf8 UTSW 11 75,395,927 (GRCm39) missense possibly damaging 0.95
R5669:Prpf8 UTSW 11 75,395,564 (GRCm39) missense probably damaging 1.00
R5948:Prpf8 UTSW 11 75,400,015 (GRCm39) missense possibly damaging 0.95
R6073:Prpf8 UTSW 11 75,384,848 (GRCm39) critical splice donor site probably null
R6250:Prpf8 UTSW 11 75,384,334 (GRCm39) missense possibly damaging 0.95
R6358:Prpf8 UTSW 11 75,382,321 (GRCm39) missense probably benign 0.33
R6629:Prpf8 UTSW 11 75,386,252 (GRCm39) splice site probably null
R6804:Prpf8 UTSW 11 75,390,635 (GRCm39) missense possibly damaging 0.71
R6922:Prpf8 UTSW 11 75,381,562 (GRCm39) missense probably damaging 1.00
R7035:Prpf8 UTSW 11 75,395,654 (GRCm39) missense possibly damaging 0.72
R7038:Prpf8 UTSW 11 75,386,984 (GRCm39) missense probably benign 0.02
R7089:Prpf8 UTSW 11 75,399,374 (GRCm39) missense probably damaging 0.99
R7101:Prpf8 UTSW 11 75,381,226 (GRCm39) missense possibly damaging 0.85
R7114:Prpf8 UTSW 11 75,394,181 (GRCm39) nonsense probably null
R7182:Prpf8 UTSW 11 75,381,553 (GRCm39) missense possibly damaging 0.96
R7290:Prpf8 UTSW 11 75,384,783 (GRCm39) missense possibly damaging 0.85
R7323:Prpf8 UTSW 11 75,382,610 (GRCm39) missense probably benign 0.32
R7485:Prpf8 UTSW 11 75,399,738 (GRCm39) nonsense probably null
R7522:Prpf8 UTSW 11 75,400,102 (GRCm39) missense possibly damaging 0.82
R7546:Prpf8 UTSW 11 75,399,200 (GRCm39) missense probably damaging 1.00
R7596:Prpf8 UTSW 11 75,382,330 (GRCm39) missense probably benign 0.03
R7699:Prpf8 UTSW 11 75,391,022 (GRCm39) missense probably benign 0.02
R7731:Prpf8 UTSW 11 75,399,732 (GRCm39) missense probably damaging 0.97
R7821:Prpf8 UTSW 11 75,385,300 (GRCm39) missense probably benign 0.01
R7932:Prpf8 UTSW 11 75,383,423 (GRCm39) missense possibly damaging 0.92
R8039:Prpf8 UTSW 11 75,393,368 (GRCm39) missense possibly damaging 0.95
R8067:Prpf8 UTSW 11 75,390,976 (GRCm39) missense probably damaging 0.98
R8316:Prpf8 UTSW 11 75,390,641 (GRCm39) missense possibly damaging 0.71
R8560:Prpf8 UTSW 11 75,382,600 (GRCm39) nonsense probably null
R8823:Prpf8 UTSW 11 75,384,282 (GRCm39) missense probably benign 0.05
R8977:Prpf8 UTSW 11 75,386,870 (GRCm39) missense probably benign 0.12
R9116:Prpf8 UTSW 11 75,380,589 (GRCm39) missense possibly damaging 0.71
R9166:Prpf8 UTSW 11 75,387,340 (GRCm39) missense possibly damaging 0.53
R9360:Prpf8 UTSW 11 75,381,156 (GRCm39) missense possibly damaging 0.95
R9453:Prpf8 UTSW 11 75,397,212 (GRCm39) missense possibly damaging 0.56
R9518:Prpf8 UTSW 11 75,394,486 (GRCm39) missense possibly damaging 0.72
R9532:Prpf8 UTSW 11 75,385,608 (GRCm39) missense probably benign 0.01
R9626:Prpf8 UTSW 11 75,385,681 (GRCm39) missense possibly damaging 0.53
R9760:Prpf8 UTSW 11 75,394,257 (GRCm39) missense probably benign 0.20
X0028:Prpf8 UTSW 11 75,397,590 (GRCm39) missense probably damaging 0.99
Z1177:Prpf8 UTSW 11 75,394,160 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ACCCAGACGCTTCACTGTAC -3'
(R):5'- GAGCATTGGTCAGCTTCTTCCAC -3'

Sequencing Primer
(F):5'- AGACGCTTCACTGTACTTGCC -3'
(R):5'- TGGACTCCTCAAAGCCACTGG -3'
Posted On 2017-02-15