Incidental Mutation 'R5887:Serpina1f'
ID456180
Institutional Source Beutler Lab
Gene Symbol Serpina1f
Ensembl Gene ENSMUSG00000021081
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 1F
Synonymsepserin, 0610012A11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.026) question?
Stock #R5887 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location103688044-103695529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103689787 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 394 (D394G)
Ref Sequence ENSEMBL: ENSMUSP00000113736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021490] [ENSMUST00000117053] [ENSMUST00000118101]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021490
AA Change: D394G

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021490
Gene: ENSMUSG00000021081
AA Change: D394G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SERPIN 53 409 7.69e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117053
AA Change: D339G

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112533
Gene: ENSMUSG00000021081
AA Change: D339G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SERPIN 53 354 1.23e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118101
AA Change: D394G

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113736
Gene: ENSMUSG00000021081
AA Change: D394G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SERPIN 53 409 7.69e-85 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik C T 6: 91,915,143 Q129* probably null Het
Acad8 A T 9: 26,979,324 probably null Het
AK157302 T C 13: 21,495,409 I35T possibly damaging Het
Arfgef3 G T 10: 18,607,665 S1437* probably null Het
Calcrl A T 2: 84,370,497 W68R probably damaging Het
Cd59a A G 2: 104,104,201 R5G probably damaging Het
Chl1 C T 6: 103,717,604 A1091V probably benign Het
Copg1 T C 6: 87,902,297 F442L probably damaging Het
Creld1 T C 6: 113,492,899 *421Q probably null Het
Crocc2 T A 1: 93,194,116 H662Q possibly damaging Het
Csf2ra G A 19: 61,227,328 A13V possibly damaging Het
Cul3 T C 1: 80,276,422 T546A possibly damaging Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Dock6 T A 9: 21,820,394 H1173L probably damaging Het
Dpysl4 T C 7: 139,096,276 I328T possibly damaging Het
Dspp G A 5: 104,175,455 G155R probably damaging Het
Fam208a T A 14: 27,466,297 L900* probably null Het
Fbxo33 A T 12: 59,204,759 C57* probably null Het
Frrs1 T A 3: 116,896,750 V14D probably benign Het
Gm13199 C T 2: 5,862,302 G96S unknown Het
Gm609 T A 16: 45,417,916 L178F probably damaging Het
Gpr155 A T 2: 73,343,718 C754* probably null Het
Gpr62 A T 9: 106,465,615 V38E probably damaging Het
Kcnt2 C A 1: 140,425,366 P271H probably damaging Het
Kpna3 C T 14: 61,403,012 V34I probably benign Het
Lamb1 C T 12: 31,266,864 Q71* probably null Het
Lipk T C 19: 34,039,107 I245T possibly damaging Het
Lrp1b T G 2: 40,821,707 N3281T possibly damaging Het
Lrp5 A C 19: 3,604,094 I1111S probably benign Het
Mmrn1 T C 6: 60,987,074 V1020A probably benign Het
Olfr1212 G A 2: 88,958,754 C96Y possibly damaging Het
Olfr912 G A 9: 38,581,784 C169Y probably damaging Het
Olfr954 T C 9: 39,461,491 L17P probably damaging Het
Pcdha7 A T 18: 36,975,907 T662S probably damaging Het
Pcdhga6 A G 18: 37,708,559 D444G probably damaging Het
Pkd2 T G 5: 104,498,539 D737E probably damaging Het
Plcd4 C T 1: 74,551,090 R161W probably damaging Het
Prpf8 A G 11: 75,500,908 Y1494C possibly damaging Het
Rad17 A C 13: 100,633,861 probably null Het
Rbm17 A T 2: 11,585,674 F390Y probably damaging Het
Rhod A T 19: 4,439,287 L22Q probably damaging Het
Spocd1 A T 4: 129,948,959 S56C probably damaging Het
St7l G A 3: 104,874,928 R207H probably benign Het
Tbx18 T C 9: 87,713,513 D336G possibly damaging Het
Tfg A T 16: 56,694,416 Y135* probably null Het
Tjp2 A G 19: 24,096,599 L1108P probably benign Het
Tmem150c C A 5: 100,095,665 V8L probably benign Het
Ttn A T 2: 76,916,445 H4753Q probably benign Het
Tyw1 T A 5: 130,325,699 I589N probably damaging Het
Usp40 C T 1: 87,999,870 R139Q probably damaging Het
Zgrf1 A G 3: 127,584,765 Y174C probably damaging Het
Other mutations in Serpina1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Serpina1f APN 12 103691869 missense probably benign 0.02
IGL00757:Serpina1f APN 12 103693462 missense probably damaging 1.00
IGL01123:Serpina1f APN 12 103694006 missense possibly damaging 0.47
IGL01695:Serpina1f APN 12 103693684 missense probably damaging 1.00
IGL01791:Serpina1f APN 12 103693502 missense probably damaging 1.00
IGL01868:Serpina1f APN 12 103693445 missense probably benign 0.24
IGL02135:Serpina1f APN 12 103693715 missense possibly damaging 0.90
IGL03025:Serpina1f APN 12 103693546 missense probably damaging 0.99
IGL03331:Serpina1f APN 12 103690891 missense probably benign 0.04
R0084:Serpina1f UTSW 12 103693588 missense possibly damaging 0.82
R0492:Serpina1f UTSW 12 103693567 missense possibly damaging 0.72
R0893:Serpina1f UTSW 12 103693835 missense probably damaging 0.97
R2202:Serpina1f UTSW 12 103693396 missense possibly damaging 0.75
R3974:Serpina1f UTSW 12 103693571 nonsense probably null
R4179:Serpina1f UTSW 12 103691920 missense probably benign 0.08
R4736:Serpina1f UTSW 12 103693546 missense probably damaging 0.97
R4948:Serpina1f UTSW 12 103689751 missense probably damaging 1.00
R5092:Serpina1f UTSW 12 103693550 missense probably damaging 1.00
R5416:Serpina1f UTSW 12 103693944 missense possibly damaging 0.68
R5887:Serpina1f UTSW 12 103693631 nonsense probably null
R6413:Serpina1f UTSW 12 103693694 missense probably damaging 1.00
R6566:Serpina1f UTSW 12 103693535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGATGCACTGTGACCTGG -3'
(R):5'- TGTTGCCTGCTTCTGACAAG -3'

Sequencing Primer
(F):5'- ATGCACTGTGACCTGGAGACC -3'
(R):5'- GCTCCTGCTTCTCTTCCTACAGG -3'
Posted On2017-02-15