Incidental Mutation 'R5889:Chrna4'
ID456206
Institutional Source Beutler Lab
Gene Symbol Chrna4
Ensembl Gene ENSMUSG00000027577
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 4
Synonymsalpha4 nAChR, Acra-4, a4 nicotinic receptor, Acra4, alpha4-nAChR
MMRRC Submission 044090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R5889 (G1)
Quality Score84
Status Validated
Chromosome2
Chromosomal Location181018380-181043546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 181028658 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Tryptophan at position 435 (L435W)
Ref Sequence ENSEMBL: ENSMUSP00000066338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067120] [ENSMUST00000108851]
Predicted Effect probably damaging
Transcript: ENSMUST00000067120
AA Change: L435W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066338
Gene: ENSMUSG00000027577
AA Change: L435W

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 245 1.4e-76 PFAM
Pfam:Neur_chan_memb 252 620 1.9e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108851
AA Change: L435W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104479
Gene: ENSMUSG00000027577
AA Change: L435W

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 245 8.4e-79 PFAM
Pfam:Neur_chan_memb 252 620 3.3e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135766
SMART Domains Protein: ENSMUSP00000125724
Gene: ENSMUSG00000027577

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 130 9.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198922
Meta Mutation Damage Score 0.0204 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nicotinic acetylcholine receptor, which belongs to a superfamily of ligand-gated ion channels that play a role in fast signal transmission at synapses. These pentameric receptors can bind acetylcholine, which causes an extensive change in conformation that leads to the opening of an ion-conducting channel across the plasma membrane. This protein is an integral membrane receptor subunit that can interact with either nAChR beta-2 or nAChR beta-4 to form a functional receptor. Mutations in this gene cause nocturnal frontal lobe epilepsy type 1. Polymorphisms in this gene that provide protection against nicotine addiction have been described. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice may show reduced chemically-elicited analgesia, susceptibility to seizures, increased anxiety, and altered behavioral responses to nicotine or a new environment. Homozygotes for any of several knock-in alleles exhibit altered nervous system physiology and/or sensitivity to nicotine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,449 E297G probably damaging Het
Astn1 C T 1: 158,600,380 P707L possibly damaging Het
Cep290 T C 10: 100,499,074 S319P possibly damaging Het
Cilp C A 9: 65,280,343 A1240D possibly damaging Het
Col17a1 A G 19: 47,649,072 F1249S possibly damaging Het
Creb3l3 T C 10: 81,092,533 probably benign Het
Cyp4f40 C A 17: 32,675,757 T432N probably benign Het
Dsg1c T G 18: 20,283,601 I853R possibly damaging Het
Ebna1bp2 T A 4: 118,621,423 D34E probably damaging Het
Edc4 C T 8: 105,888,022 T112I possibly damaging Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Exoc6 A G 19: 37,582,245 H291R probably damaging Het
Fbln5 G T 12: 101,765,226 N236K probably damaging Het
Fndc8 A T 11: 82,898,729 T238S probably damaging Het
Frem3 T C 8: 80,614,288 V1070A probably damaging Het
Gabra4 A T 5: 71,571,891 N515K possibly damaging Het
Gemin5 A G 11: 58,122,355 V1422A possibly damaging Het
Gm10118 A G 10: 63,927,111 probably benign Het
Grm5 A G 7: 87,603,073 D177G probably damaging Het
Gtf2h4 G A 17: 35,670,900 P147L possibly damaging Het
Hgsnat T C 8: 25,963,367 D265G probably damaging Het
Hsd17b4 T A 18: 50,177,209 L513Q probably damaging Het
Hsd17b7 A T 1: 169,955,918 M307K probably benign Het
Hspa5 T C 2: 34,774,617 V361A probably damaging Het
Iqgap2 A G 13: 95,632,042 V1450A probably benign Het
Itpr3 A G 17: 27,115,065 E2037G probably damaging Het
Lama5 T C 2: 180,193,674 probably benign Het
Manba G T 3: 135,524,598 G311* probably null Het
Mettl24 T A 10: 40,746,490 V236E probably benign Het
Myh3 A G 11: 67,086,375 D310G probably damaging Het
Ncoa4 A T 14: 32,166,659 probably benign Het
Nop56 G T 2: 130,275,982 R126L probably damaging Het
Nos3 C A 5: 24,368,777 probably benign Het
Olfr156 T C 4: 43,820,492 M290V possibly damaging Het
Pcdhga3 T A 18: 37,676,609 V705D probably damaging Het
Prom2 C T 2: 127,529,411 A776T possibly damaging Het
Prss48 A G 3: 85,998,185 I127T probably damaging Het
Rtca T C 3: 116,499,583 Y193C possibly damaging Het
Samd9l T C 6: 3,376,460 Y267C probably damaging Het
Scube3 A G 17: 28,160,913 R272G possibly damaging Het
Sprr1a G T 3: 92,484,644 H17N probably benign Het
Ssfa2 T A 2: 79,657,728 D718E probably damaging Het
Stard3 G C 11: 98,375,535 Q120H probably benign Het
Supt6 A G 11: 78,212,748 I1377T probably damaging Het
Svop A T 5: 114,065,631 S30T probably benign Het
Syne2 T A 12: 76,072,252 L5882* probably null Het
Tanc2 G T 11: 105,921,807 R1359L probably benign Het
Tmc7 A C 7: 118,566,326 L55R probably benign Het
Trappc11 G A 8: 47,519,578 A320V probably benign Het
Ttll8 G C 15: 88,933,939 P178A probably damaging Het
Ttn T C 2: 76,730,649 E20809G probably damaging Het
Tubb2a A T 13: 34,075,468 V113E possibly damaging Het
Ube2d1 A T 10: 71,259,869 probably benign Het
Usp48 T C 4: 137,616,412 V452A probably benign Het
Vldlr T A 19: 27,239,664 I39N probably damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Zyg11b C T 4: 108,237,380 W669* probably null Het
Other mutations in Chrna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Chrna4 APN 2 181029391 missense probably benign 0.09
IGL00914:Chrna4 APN 2 181029031 missense probably damaging 1.00
IGL01511:Chrna4 APN 2 181028668 missense probably benign 0.13
IGL02517:Chrna4 APN 2 181029133 missense probably benign 0.01
IGL02715:Chrna4 APN 2 181029581 unclassified probably benign
R1168:Chrna4 UTSW 2 181034138 missense possibly damaging 0.61
R1475:Chrna4 UTSW 2 181029379 missense probably benign 0.44
R1572:Chrna4 UTSW 2 181029307 missense possibly damaging 0.95
R4428:Chrna4 UTSW 2 181028620 missense probably damaging 0.99
R4429:Chrna4 UTSW 2 181028620 missense probably damaging 0.99
R4431:Chrna4 UTSW 2 181028620 missense probably damaging 0.99
R4494:Chrna4 UTSW 2 181028488 missense probably damaging 0.98
R4664:Chrna4 UTSW 2 181037493 missense probably damaging 1.00
R4666:Chrna4 UTSW 2 181037493 missense probably damaging 1.00
R4931:Chrna4 UTSW 2 181028872 missense probably benign 0.00
R5144:Chrna4 UTSW 2 181024830 missense probably damaging 1.00
R5556:Chrna4 UTSW 2 181033980 missense possibly damaging 0.94
R5633:Chrna4 UTSW 2 181029460 missense probably damaging 1.00
R6056:Chrna4 UTSW 2 181029442 missense probably damaging 1.00
R6120:Chrna4 UTSW 2 181024806 missense probably damaging 1.00
R7030:Chrna4 UTSW 2 181029541 missense probably damaging 1.00
R7352:Chrna4 UTSW 2 181037474 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGTACTGGATACTCCGAGACC -3'
(R):5'- GCCCATCTGTGGTCAAAGAC -3'

Sequencing Primer
(F):5'- GAGACCGGCAGCGGATG -3'
(R):5'- TGCCGGAGACTTATCGAATC -3'
Posted On2017-02-15