Incidental Mutation 'R5889:Tanc2'
ID456236
Institutional Source Beutler Lab
Gene Symbol Tanc2
Ensembl Gene ENSMUSG00000053580
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms5730590C14Rik, 3526402J09Rik
MMRRC Submission 044090-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5889 (G1)
Quality Score196
Status Validated
Chromosome11
Chromosomal Location105589986-105929304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105921807 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1359 (R1359L)
Ref Sequence ENSEMBL: ENSMUSP00000097904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100330]
Predicted Effect silent
Transcript: ENSMUST00000089485
SMART Domains Protein: ENSMUSP00000086912
Gene: ENSMUSG00000053580

DomainStartEndE-ValueType
ANK 35 63 1.16e3 SMART
ANK 78 107 3.31e-1 SMART
ANK 111 140 7.71e-2 SMART
ANK 144 173 6.12e-5 SMART
ANK 177 206 8.99e-3 SMART
ANK 210 239 5.71e-5 SMART
ANK 243 272 2.11e2 SMART
Blast:TPR 289 322 3e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000100330
AA Change: R1359L

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580
AA Change: R1359L

DomainStartEndE-ValueType
low complexity region 32 50 N/A INTRINSIC
low complexity region 129 152 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ANK 846 878 2.08e3 SMART
ANK 882 913 2.97e2 SMART
ANK 917 946 5.75e-1 SMART
ANK 950 979 8.62e1 SMART
ANK 990 1018 1.16e3 SMART
ANK 1033 1062 3.31e-1 SMART
ANK 1066 1095 7.71e-2 SMART
ANK 1099 1128 6.12e-5 SMART
ANK 1132 1161 8.99e-3 SMART
ANK 1165 1194 5.71e-5 SMART
ANK 1198 1227 2.11e2 SMART
TPR 1244 1277 3.89e1 SMART
TPR 1291 1324 3.61e-2 SMART
TPR 1325 1358 2.82e-4 SMART
low complexity region 1369 1406 N/A INTRINSIC
low complexity region 1533 1539 N/A INTRINSIC
low complexity region 1787 1802 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000146162
AA Change: R501L
SMART Domains Protein: ENSMUSP00000123674
Gene: ENSMUSG00000053580
AA Change: R501L

DomainStartEndE-ValueType
ANK 15 46 2.97e2 SMART
ANK 50 79 5.75e-1 SMART
ANK 83 112 8.62e1 SMART
ANK 123 151 1.16e3 SMART
ANK 166 195 3.31e-1 SMART
ANK 199 228 7.71e-2 SMART
ANK 232 261 6.12e-5 SMART
ANK 265 294 8.99e-3 SMART
ANK 298 327 5.71e-5 SMART
ANK 331 360 3.44e1 SMART
TPR 387 420 3.89e1 SMART
TPR 434 467 3.61e-2 SMART
TPR 468 501 2.82e-4 SMART
low complexity region 512 549 N/A INTRINSIC
low complexity region 676 682 N/A INTRINSIC
low complexity region 930 945 N/A INTRINSIC
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,449 E297G probably damaging Het
Astn1 C T 1: 158,600,380 P707L possibly damaging Het
Cep290 T C 10: 100,499,074 S319P possibly damaging Het
Chrna4 A C 2: 181,028,658 L435W probably damaging Het
Cilp C A 9: 65,280,343 A1240D possibly damaging Het
Col17a1 A G 19: 47,649,072 F1249S possibly damaging Het
Creb3l3 T C 10: 81,092,533 probably benign Het
Cyp4f40 C A 17: 32,675,757 T432N probably benign Het
Dsg1c T G 18: 20,283,601 I853R possibly damaging Het
Ebna1bp2 T A 4: 118,621,423 D34E probably damaging Het
Edc4 C T 8: 105,888,022 T112I possibly damaging Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Exoc6 A G 19: 37,582,245 H291R probably damaging Het
Fbln5 G T 12: 101,765,226 N236K probably damaging Het
Fndc8 A T 11: 82,898,729 T238S probably damaging Het
Frem3 T C 8: 80,614,288 V1070A probably damaging Het
Gabra4 A T 5: 71,571,891 N515K possibly damaging Het
Gemin5 A G 11: 58,122,355 V1422A possibly damaging Het
Gm10118 A G 10: 63,927,111 probably benign Het
Grm5 A G 7: 87,603,073 D177G probably damaging Het
Gtf2h4 G A 17: 35,670,900 P147L possibly damaging Het
Hgsnat T C 8: 25,963,367 D265G probably damaging Het
Hsd17b4 T A 18: 50,177,209 L513Q probably damaging Het
Hsd17b7 A T 1: 169,955,918 M307K probably benign Het
Hspa5 T C 2: 34,774,617 V361A probably damaging Het
Iqgap2 A G 13: 95,632,042 V1450A probably benign Het
Itpr3 A G 17: 27,115,065 E2037G probably damaging Het
Lama5 T C 2: 180,193,674 probably benign Het
Manba G T 3: 135,524,598 G311* probably null Het
Mettl24 T A 10: 40,746,490 V236E probably benign Het
Myh3 A G 11: 67,086,375 D310G probably damaging Het
Ncoa4 A T 14: 32,166,659 probably benign Het
Nop56 G T 2: 130,275,982 R126L probably damaging Het
Nos3 C A 5: 24,368,777 probably benign Het
Olfr156 T C 4: 43,820,492 M290V possibly damaging Het
Pcdhga3 T A 18: 37,676,609 V705D probably damaging Het
Prom2 C T 2: 127,529,411 A776T possibly damaging Het
Prss48 A G 3: 85,998,185 I127T probably damaging Het
Rtca T C 3: 116,499,583 Y193C possibly damaging Het
Samd9l T C 6: 3,376,460 Y267C probably damaging Het
Scube3 A G 17: 28,160,913 R272G possibly damaging Het
Sprr1a G T 3: 92,484,644 H17N probably benign Het
Ssfa2 T A 2: 79,657,728 D718E probably damaging Het
Stard3 G C 11: 98,375,535 Q120H probably benign Het
Supt6 A G 11: 78,212,748 I1377T probably damaging Het
Svop A T 5: 114,065,631 S30T probably benign Het
Syne2 T A 12: 76,072,252 L5882* probably null Het
Tmc7 A C 7: 118,566,326 L55R probably benign Het
Trappc11 G A 8: 47,519,578 A320V probably benign Het
Ttll8 G C 15: 88,933,939 P178A probably damaging Het
Ttn T C 2: 76,730,649 E20809G probably damaging Het
Tubb2a A T 13: 34,075,468 V113E possibly damaging Het
Ube2d1 A T 10: 71,259,869 probably benign Het
Usp48 T C 4: 137,616,412 V452A probably benign Het
Vldlr T A 19: 27,239,664 I39N probably damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Zyg11b C T 4: 108,237,380 W669* probably null Het
Other mutations in Tanc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Tanc2 APN 11 105923220 missense probably benign 0.28
IGL00688:Tanc2 APN 11 105798690 missense probably damaging 1.00
IGL00709:Tanc2 APN 11 105798795 missense probably damaging 1.00
IGL01013:Tanc2 APN 11 105625065 missense probably damaging 0.96
IGL01141:Tanc2 APN 11 105886474 splice site probably benign
IGL01386:Tanc2 APN 11 105886381 missense probably damaging 0.99
IGL01433:Tanc2 APN 11 105810522 missense possibly damaging 0.75
IGL01562:Tanc2 APN 11 105780069 missense probably benign 0.00
IGL01979:Tanc2 APN 11 105776920 missense probably benign
IGL02104:Tanc2 APN 11 105780133 unclassified probably benign
IGL02434:Tanc2 APN 11 105780042 missense probably benign 0.14
IGL02534:Tanc2 APN 11 105835168 missense probably damaging 1.00
IGL02568:Tanc2 APN 11 105776951 missense probably benign 0.00
IGL03279:Tanc2 APN 11 105913092 splice site probably null
R0595:Tanc2 UTSW 11 105714177 splice site probably null
R1131:Tanc2 UTSW 11 105835002 missense probably damaging 1.00
R1320:Tanc2 UTSW 11 105886444 missense probably damaging 1.00
R1487:Tanc2 UTSW 11 105923634 missense probably damaging 0.99
R1497:Tanc2 UTSW 11 105922137 missense probably benign 0.21
R1692:Tanc2 UTSW 11 105857500 missense probably benign
R1712:Tanc2 UTSW 11 105899780 missense probably benign
R1793:Tanc2 UTSW 11 105625033 critical splice acceptor site probably null
R1812:Tanc2 UTSW 11 105886386 missense probably benign 0.01
R1905:Tanc2 UTSW 11 105922863 missense possibly damaging 0.61
R1959:Tanc2 UTSW 11 105910295 missense probably damaging 1.00
R1962:Tanc2 UTSW 11 105798732 missense probably benign 0.14
R2122:Tanc2 UTSW 11 105895949 missense probably damaging 1.00
R2174:Tanc2 UTSW 11 105910309 missense probably benign 0.00
R2341:Tanc2 UTSW 11 105835051 missense probably benign 0.09
R2497:Tanc2 UTSW 11 105673493 critical splice donor site probably null
R3438:Tanc2 UTSW 11 105857575 missense probably damaging 0.97
R3711:Tanc2 UTSW 11 105798690 missense probably damaging 1.00
R3765:Tanc2 UTSW 11 105914970 missense probably damaging 1.00
R3890:Tanc2 UTSW 11 105798678 missense probably damaging 1.00
R4193:Tanc2 UTSW 11 105914062 intron probably benign
R4609:Tanc2 UTSW 11 105910240 missense probably benign 0.24
R4674:Tanc2 UTSW 11 105867480 missense probably damaging 1.00
R4928:Tanc2 UTSW 11 105867762 missense probably damaging 1.00
R5008:Tanc2 UTSW 11 105625060 start codon destroyed probably null 0.46
R5010:Tanc2 UTSW 11 105780092 missense probably damaging 1.00
R5135:Tanc2 UTSW 11 105857553 missense possibly damaging 0.93
R5385:Tanc2 UTSW 11 105776846 missense probably damaging 0.99
R5409:Tanc2 UTSW 11 105867485 missense possibly damaging 0.93
R5419:Tanc2 UTSW 11 105922883 missense probably benign 0.00
R5501:Tanc2 UTSW 11 105914985 critical splice donor site probably null
R5590:Tanc2 UTSW 11 105923306 missense probably damaging 0.99
R5651:Tanc2 UTSW 11 105798700 missense probably benign 0.44
R5798:Tanc2 UTSW 11 105921855 small deletion probably benign
R5876:Tanc2 UTSW 11 105922613 missense possibly damaging 0.71
R5958:Tanc2 UTSW 11 105840625 missense probably benign 0.00
R5999:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105923672 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105896547 missense possibly damaging 0.68
R6048:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6049:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6185:Tanc2 UTSW 11 105913039 missense probably damaging 1.00
R6335:Tanc2 UTSW 11 105857556 missense probably damaging 0.99
R6821:Tanc2 UTSW 11 105886490 intron probably null
R6846:Tanc2 UTSW 11 105798653 missense probably benign 0.34
R6857:Tanc2 UTSW 11 105910288 missense possibly damaging 0.81
R6904:Tanc2 UTSW 11 105835230 missense possibly damaging 0.89
R7009:Tanc2 UTSW 11 105840699 missense possibly damaging 0.47
R7017:Tanc2 UTSW 11 105923108 missense probably benign
R7371:Tanc2 UTSW 11 105798596 missense probably benign
X0027:Tanc2 UTSW 11 105835183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AAATGCTACCTGATGCAGTTCTC -3'
(R):5'- TGTCTGGAGGCCAATAGAAAC -3'

Sequencing Primer
(F):5'- CAGTTCTCTGAATTGGTGGCC -3'
(R):5'- GTCTGGAGGCCAATAGAAACATTTTC -3'
Posted On2017-02-15