Incidental Mutation 'R5889:Ncoa4'
ID456241
Institutional Source Beutler Lab
Gene Symbol Ncoa4
Ensembl Gene ENSMUSG00000056234
Gene Namenuclear receptor coactivator 4
Synonyms
MMRRC Submission 044090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5889 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location32159865-32179855 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 32166659 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111994] [ENSMUST00000163336] [ENSMUST00000164341] [ENSMUST00000168034] [ENSMUST00000168114] [ENSMUST00000168334] [ENSMUST00000168385] [ENSMUST00000169722] [ENSMUST00000226479]
Predicted Effect probably benign
Transcript: ENSMUST00000111994
SMART Domains Protein: ENSMUSP00000107625
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 168 5e-44 PFAM
Pfam:ARA70 197 338 5.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163336
SMART Domains Protein: ENSMUSP00000126071
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 33 169 2.4e-28 PFAM
Pfam:ARA70 199 334 4.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164341
SMART Domains Protein: ENSMUSP00000126780
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 99 3.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168034
SMART Domains Protein: ENSMUSP00000129422
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 45 131 1.3e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168114
AA Change: T3S
SMART Domains Protein: ENSMUSP00000131253
Gene: ENSMUSG00000056234
AA Change: T3S

DomainStartEndE-ValueType
Pfam:ARA70 64 105 2.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168334
SMART Domains Protein: ENSMUSP00000128739
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 96 1.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168385
SMART Domains Protein: ENSMUSP00000126222
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 1 73 8.2e-24 PFAM
Pfam:ARA70 102 205 2.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169722
SMART Domains Protein: ENSMUSP00000129917
Gene: ENSMUSG00000056234

DomainStartEndE-ValueType
Pfam:ARA70 37 168 6.5e-45 PFAM
Pfam:ARA70 196 337 6.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228143
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an androgen receptor coactivator. The encoded protein interacts with the androgen receptor in a ligand-dependent manner to enhance its transcriptional activity. Chromosomal translocations between this gene and the ret tyrosine kinase gene, also located on chromosome 10, have been associated with papillary thyroid carcinoma. Alternatively spliced transcript variants have been described. Pseudogenes are present on chromosomes 4, 5, 10, and 14. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mouse embryonic fibroblasts isolated from homozygous null mice exhibit abnormal DNA replication, decreased fibroblast proliferation, and early cellular replicative senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,449 E297G probably damaging Het
Astn1 C T 1: 158,600,380 P707L possibly damaging Het
Cep290 T C 10: 100,499,074 S319P possibly damaging Het
Chrna4 A C 2: 181,028,658 L435W probably damaging Het
Cilp C A 9: 65,280,343 A1240D possibly damaging Het
Col17a1 A G 19: 47,649,072 F1249S possibly damaging Het
Creb3l3 T C 10: 81,092,533 probably benign Het
Cyp4f40 C A 17: 32,675,757 T432N probably benign Het
Dsg1c T G 18: 20,283,601 I853R possibly damaging Het
Ebna1bp2 T A 4: 118,621,423 D34E probably damaging Het
Edc4 C T 8: 105,888,022 T112I possibly damaging Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Exoc6 A G 19: 37,582,245 H291R probably damaging Het
Fbln5 G T 12: 101,765,226 N236K probably damaging Het
Fndc8 A T 11: 82,898,729 T238S probably damaging Het
Frem3 T C 8: 80,614,288 V1070A probably damaging Het
Gabra4 A T 5: 71,571,891 N515K possibly damaging Het
Gemin5 A G 11: 58,122,355 V1422A possibly damaging Het
Gm10118 A G 10: 63,927,111 probably benign Het
Grm5 A G 7: 87,603,073 D177G probably damaging Het
Gtf2h4 G A 17: 35,670,900 P147L possibly damaging Het
Hgsnat T C 8: 25,963,367 D265G probably damaging Het
Hsd17b4 T A 18: 50,177,209 L513Q probably damaging Het
Hsd17b7 A T 1: 169,955,918 M307K probably benign Het
Hspa5 T C 2: 34,774,617 V361A probably damaging Het
Iqgap2 A G 13: 95,632,042 V1450A probably benign Het
Itpr3 A G 17: 27,115,065 E2037G probably damaging Het
Lama5 T C 2: 180,193,674 probably benign Het
Manba G T 3: 135,524,598 G311* probably null Het
Mettl24 T A 10: 40,746,490 V236E probably benign Het
Myh3 A G 11: 67,086,375 D310G probably damaging Het
Nop56 G T 2: 130,275,982 R126L probably damaging Het
Nos3 C A 5: 24,368,777 probably benign Het
Olfr156 T C 4: 43,820,492 M290V possibly damaging Het
Pcdhga3 T A 18: 37,676,609 V705D probably damaging Het
Prom2 C T 2: 127,529,411 A776T possibly damaging Het
Prss48 A G 3: 85,998,185 I127T probably damaging Het
Rtca T C 3: 116,499,583 Y193C possibly damaging Het
Samd9l T C 6: 3,376,460 Y267C probably damaging Het
Scube3 A G 17: 28,160,913 R272G possibly damaging Het
Sprr1a G T 3: 92,484,644 H17N probably benign Het
Ssfa2 T A 2: 79,657,728 D718E probably damaging Het
Stard3 G C 11: 98,375,535 Q120H probably benign Het
Supt6 A G 11: 78,212,748 I1377T probably damaging Het
Svop A T 5: 114,065,631 S30T probably benign Het
Syne2 T A 12: 76,072,252 L5882* probably null Het
Tanc2 G T 11: 105,921,807 R1359L probably benign Het
Tmc7 A C 7: 118,566,326 L55R probably benign Het
Trappc11 G A 8: 47,519,578 A320V probably benign Het
Ttll8 G C 15: 88,933,939 P178A probably damaging Het
Ttn T C 2: 76,730,649 E20809G probably damaging Het
Tubb2a A T 13: 34,075,468 V113E possibly damaging Het
Ube2d1 A T 10: 71,259,869 probably benign Het
Usp48 T C 4: 137,616,412 V452A probably benign Het
Vldlr T A 19: 27,239,664 I39N probably damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Zyg11b C T 4: 108,237,380 W669* probably null Het
Other mutations in Ncoa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ncoa4 APN 14 32172927 missense probably benign 0.19
IGL02963:Ncoa4 APN 14 32176509 missense probably damaging 1.00
IGL03062:Ncoa4 APN 14 32173420 missense possibly damaging 0.89
R0613:Ncoa4 UTSW 14 32176552 missense probably damaging 1.00
R1353:Ncoa4 UTSW 14 32170858 nonsense probably null
R1395:Ncoa4 UTSW 14 32172841 intron probably null
R1430:Ncoa4 UTSW 14 32176722 missense probably benign 0.00
R1509:Ncoa4 UTSW 14 32173434 missense probably damaging 1.00
R1541:Ncoa4 UTSW 14 32176888 missense probably damaging 1.00
R2292:Ncoa4 UTSW 14 32173456 missense probably damaging 0.98
R4610:Ncoa4 UTSW 14 32176725 missense probably benign 0.01
R4713:Ncoa4 UTSW 14 32176641 missense probably benign 0.05
R5750:Ncoa4 UTSW 14 32177307 nonsense probably null
R5928:Ncoa4 UTSW 14 32166721 critical splice donor site probably null
R6738:Ncoa4 UTSW 14 32170793 missense probably benign
R7065:Ncoa4 UTSW 14 32172900 nonsense probably null
R7165:Ncoa4 UTSW 14 32175983 missense probably damaging 0.97
R7257:Ncoa4 UTSW 14 32177369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTGACTCAACTGCCAGG -3'
(R):5'- CTCAACCCATGAATTGTATTTGCC -3'

Sequencing Primer
(F):5'- GAGGTAGAGAGATTATCTATTCCAGC -3'
(R):5'- AAGCAGTGTTCCAGAACC -3'
Posted On2017-02-15