Incidental Mutation 'R5889:Gtf2h4'
ID456247
Institutional Source Beutler Lab
Gene Symbol Gtf2h4
Ensembl Gene ENSMUSG00000001524
Gene Namegeneral transcription factor II H, polypeptide 4
Synonymsp52
MMRRC Submission 044090-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R5889 (G1)
Quality Score138
Status Validated
Chromosome17
Chromosomal Location35667730-35673739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35670900 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 147 (P147L)
Ref Sequence ENSEMBL: ENSMUSP00000124683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001565] [ENSMUST00000043674] [ENSMUST00000159852] [ENSMUST00000160039] [ENSMUST00000160734] [ENSMUST00000160752] [ENSMUST00000162266] [ENSMUST00000165144]
Predicted Effect probably benign
Transcript: ENSMUST00000001565
AA Change: P147L

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000001565
Gene: ENSMUSG00000001524
AA Change: P147L

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 6.4e-141 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000043674
SMART Domains Protein: ENSMUSP00000047917
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 112 736 3.3e-179 PFAM
Pfam:tRNA-synt_1g 141 221 2e-8 PFAM
Pfam:Anticodon_1 780 932 3.6e-32 PFAM
low complexity region 1005 1015 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159671
Predicted Effect probably benign
Transcript: ENSMUST00000159852
SMART Domains Protein: ENSMUSP00000124060
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 61 1.6e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160039
AA Change: P147L

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124683
Gene: ENSMUSG00000001524
AA Change: P147L

DomainStartEndE-ValueType
Pfam:Tfb2 22 164 2.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160711
Predicted Effect probably benign
Transcript: ENSMUST00000160734
AA Change: P147L

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124335
Gene: ENSMUSG00000001524
AA Change: P147L

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 1.9e-137 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160752
AA Change: P146S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124458
Gene: ENSMUSG00000001524
AA Change: P146S

DomainStartEndE-ValueType
Pfam:Tfb2 22 160 6.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162266
SMART Domains Protein: ENSMUSP00000124103
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 91 1.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164978
Predicted Effect probably benign
Transcript: ENSMUST00000165144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171536
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: This gene encodes a subunit of the general transcription factor multiprotein complex that plays roles in basal transcription, DNA repair and cell cycle control. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,449 E297G probably damaging Het
Astn1 C T 1: 158,600,380 P707L possibly damaging Het
Cep290 T C 10: 100,499,074 S319P possibly damaging Het
Chrna4 A C 2: 181,028,658 L435W probably damaging Het
Cilp C A 9: 65,280,343 A1240D possibly damaging Het
Col17a1 A G 19: 47,649,072 F1249S possibly damaging Het
Creb3l3 T C 10: 81,092,533 probably benign Het
Cyp4f40 C A 17: 32,675,757 T432N probably benign Het
Dsg1c T G 18: 20,283,601 I853R possibly damaging Het
Ebna1bp2 T A 4: 118,621,423 D34E probably damaging Het
Edc4 C T 8: 105,888,022 T112I possibly damaging Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Exoc6 A G 19: 37,582,245 H291R probably damaging Het
Fbln5 G T 12: 101,765,226 N236K probably damaging Het
Fndc8 A T 11: 82,898,729 T238S probably damaging Het
Frem3 T C 8: 80,614,288 V1070A probably damaging Het
Gabra4 A T 5: 71,571,891 N515K possibly damaging Het
Gemin5 A G 11: 58,122,355 V1422A possibly damaging Het
Gm10118 A G 10: 63,927,111 probably benign Het
Grm5 A G 7: 87,603,073 D177G probably damaging Het
Hgsnat T C 8: 25,963,367 D265G probably damaging Het
Hsd17b4 T A 18: 50,177,209 L513Q probably damaging Het
Hsd17b7 A T 1: 169,955,918 M307K probably benign Het
Hspa5 T C 2: 34,774,617 V361A probably damaging Het
Iqgap2 A G 13: 95,632,042 V1450A probably benign Het
Itpr3 A G 17: 27,115,065 E2037G probably damaging Het
Lama5 T C 2: 180,193,674 probably benign Het
Manba G T 3: 135,524,598 G311* probably null Het
Mettl24 T A 10: 40,746,490 V236E probably benign Het
Myh3 A G 11: 67,086,375 D310G probably damaging Het
Ncoa4 A T 14: 32,166,659 probably benign Het
Nop56 G T 2: 130,275,982 R126L probably damaging Het
Nos3 C A 5: 24,368,777 probably benign Het
Olfr156 T C 4: 43,820,492 M290V possibly damaging Het
Pcdhga3 T A 18: 37,676,609 V705D probably damaging Het
Prom2 C T 2: 127,529,411 A776T possibly damaging Het
Prss48 A G 3: 85,998,185 I127T probably damaging Het
Rtca T C 3: 116,499,583 Y193C possibly damaging Het
Samd9l T C 6: 3,376,460 Y267C probably damaging Het
Scube3 A G 17: 28,160,913 R272G possibly damaging Het
Sprr1a G T 3: 92,484,644 H17N probably benign Het
Ssfa2 T A 2: 79,657,728 D718E probably damaging Het
Stard3 G C 11: 98,375,535 Q120H probably benign Het
Supt6 A G 11: 78,212,748 I1377T probably damaging Het
Svop A T 5: 114,065,631 S30T probably benign Het
Syne2 T A 12: 76,072,252 L5882* probably null Het
Tanc2 G T 11: 105,921,807 R1359L probably benign Het
Tmc7 A C 7: 118,566,326 L55R probably benign Het
Trappc11 G A 8: 47,519,578 A320V probably benign Het
Ttll8 G C 15: 88,933,939 P178A probably damaging Het
Ttn T C 2: 76,730,649 E20809G probably damaging Het
Tubb2a A T 13: 34,075,468 V113E possibly damaging Het
Ube2d1 A T 10: 71,259,869 probably benign Het
Usp48 T C 4: 137,616,412 V452A probably benign Het
Vldlr T A 19: 27,239,664 I39N probably damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Zyg11b C T 4: 108,237,380 W669* probably null Het
Other mutations in Gtf2h4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Gtf2h4 APN 17 35669982 missense probably damaging 1.00
IGL03412:Gtf2h4 APN 17 35668483 missense probably damaging 0.98
miramont UTSW 17 32345378 missense probably damaging 0.97
R0112:Gtf2h4 UTSW 17 35670448 missense possibly damaging 0.93
R0554:Gtf2h4 UTSW 17 35668639 missense probably benign 0.06
R0928:Gtf2h4 UTSW 17 35670885 missense probably damaging 1.00
R1917:Gtf2h4 UTSW 17 35670198 missense possibly damaging 0.59
R1918:Gtf2h4 UTSW 17 35670198 missense possibly damaging 0.59
R2264:Gtf2h4 UTSW 17 35668664 unclassified probably benign
R2287:Gtf2h4 UTSW 17 35671225 critical splice donor site probably null
R2357:Gtf2h4 UTSW 17 35667999 missense probably damaging 1.00
R2519:Gtf2h4 UTSW 17 35670909 missense probably damaging 1.00
R4021:Gtf2h4 UTSW 17 35670664 missense probably benign 0.35
R4881:Gtf2h4 UTSW 17 35670233 missense possibly damaging 0.94
R5747:Gtf2h4 UTSW 17 35670381 missense possibly damaging 0.66
R6356:Gtf2h4 UTSW 17 35669755 missense probably damaging 0.99
R7323:Gtf2h4 UTSW 17 35669965 missense probably damaging 0.99
R7426:Gtf2h4 UTSW 17 35669358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCATAAGCCCGGCCTGG -3'
(R):5'- TGTAGGGTGCAGAAAATGTCC -3'

Sequencing Primer
(F):5'- TCTTGGCTGACAGCTGCAC -3'
(R):5'- GAAAATGTCCTTTTCTTGTAGCCC -3'
Posted On2017-02-15