Incidental Mutation 'R5889:Hsd17b4'
ID456250
Institutional Source Beutler Lab
Gene Symbol Hsd17b4
Ensembl Gene ENSMUSG00000024507
Gene Namehydroxysteroid (17-beta) dehydrogenase 4
SynonymsD-bifunctional protein, MFP2, multifunctional protein 2, 17[b]-HSD, Mfp-2, perMFE-2, MFE-2
MMRRC Submission 044090-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R5889 (G1)
Quality Score159
Status Validated
Chromosome18
Chromosomal Location50128201-50196269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50177209 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 513 (L513Q)
Ref Sequence ENSEMBL: ENSMUSP00000025385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025385]
Predicted Effect probably damaging
Transcript: ENSMUST00000025385
AA Change: L513Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025385
Gene: ENSMUSG00000024507
AA Change: L513Q

DomainStartEndE-ValueType
Pfam:KR 10 186 2.1e-17 PFAM
Pfam:adh_short 10 208 2.3e-39 PFAM
Pfam:MaoC_dehydrat_N 346 451 1.4e-8 PFAM
low complexity region 458 470 N/A INTRINSIC
Pfam:MaoC_dehydratas 479 600 1.8e-41 PFAM
Pfam:SCP2 627 730 8.4e-27 PFAM
Meta Mutation Damage Score 0.0204 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty acids. It also acts as a catalyst for the formation of 3-ketoacyl-CoA intermediates from both straight-chain and 2-methyl-branched-chain fatty acids. Defects in this gene that affect the peroxisomal fatty acid beta-oxidation activity are a cause of D-bifunctional protein deficiency (DBPD). An apparent pseudogene of this gene is present on chromosome 8. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in fatty acid metabolism, retarded growth, abnormal bile salt composition, impaired coordination, demyelination and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,449 E297G probably damaging Het
Astn1 C T 1: 158,600,380 P707L possibly damaging Het
Cep290 T C 10: 100,499,074 S319P possibly damaging Het
Chrna4 A C 2: 181,028,658 L435W probably damaging Het
Cilp C A 9: 65,280,343 A1240D possibly damaging Het
Col17a1 A G 19: 47,649,072 F1249S possibly damaging Het
Creb3l3 T C 10: 81,092,533 probably benign Het
Cyp4f40 C A 17: 32,675,757 T432N probably benign Het
Dsg1c T G 18: 20,283,601 I853R possibly damaging Het
Ebna1bp2 T A 4: 118,621,423 D34E probably damaging Het
Edc4 C T 8: 105,888,022 T112I possibly damaging Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Exoc6 A G 19: 37,582,245 H291R probably damaging Het
Fbln5 G T 12: 101,765,226 N236K probably damaging Het
Fndc8 A T 11: 82,898,729 T238S probably damaging Het
Frem3 T C 8: 80,614,288 V1070A probably damaging Het
Gabra4 A T 5: 71,571,891 N515K possibly damaging Het
Gemin5 A G 11: 58,122,355 V1422A possibly damaging Het
Gm10118 A G 10: 63,927,111 probably benign Het
Grm5 A G 7: 87,603,073 D177G probably damaging Het
Gtf2h4 G A 17: 35,670,900 P147L possibly damaging Het
Hgsnat T C 8: 25,963,367 D265G probably damaging Het
Hsd17b7 A T 1: 169,955,918 M307K probably benign Het
Hspa5 T C 2: 34,774,617 V361A probably damaging Het
Iqgap2 A G 13: 95,632,042 V1450A probably benign Het
Itpr3 A G 17: 27,115,065 E2037G probably damaging Het
Lama5 T C 2: 180,193,674 probably benign Het
Manba G T 3: 135,524,598 G311* probably null Het
Mettl24 T A 10: 40,746,490 V236E probably benign Het
Myh3 A G 11: 67,086,375 D310G probably damaging Het
Ncoa4 A T 14: 32,166,659 probably benign Het
Nop56 G T 2: 130,275,982 R126L probably damaging Het
Nos3 C A 5: 24,368,777 probably benign Het
Olfr156 T C 4: 43,820,492 M290V possibly damaging Het
Pcdhga3 T A 18: 37,676,609 V705D probably damaging Het
Prom2 C T 2: 127,529,411 A776T possibly damaging Het
Prss48 A G 3: 85,998,185 I127T probably damaging Het
Rtca T C 3: 116,499,583 Y193C possibly damaging Het
Samd9l T C 6: 3,376,460 Y267C probably damaging Het
Scube3 A G 17: 28,160,913 R272G possibly damaging Het
Sprr1a G T 3: 92,484,644 H17N probably benign Het
Ssfa2 T A 2: 79,657,728 D718E probably damaging Het
Stard3 G C 11: 98,375,535 Q120H probably benign Het
Supt6 A G 11: 78,212,748 I1377T probably damaging Het
Svop A T 5: 114,065,631 S30T probably benign Het
Syne2 T A 12: 76,072,252 L5882* probably null Het
Tanc2 G T 11: 105,921,807 R1359L probably benign Het
Tmc7 A C 7: 118,566,326 L55R probably benign Het
Trappc11 G A 8: 47,519,578 A320V probably benign Het
Ttll8 G C 15: 88,933,939 P178A probably damaging Het
Ttn T C 2: 76,730,649 E20809G probably damaging Het
Tubb2a A T 13: 34,075,468 V113E possibly damaging Het
Ube2d1 A T 10: 71,259,869 probably benign Het
Usp48 T C 4: 137,616,412 V452A probably benign Het
Vldlr T A 19: 27,239,664 I39N probably damaging Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Zyg11b C T 4: 108,237,380 W669* probably null Het
Other mutations in Hsd17b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Hsd17b4 APN 18 50164845 missense probably benign
IGL01369:Hsd17b4 APN 18 50172033 missense possibly damaging 0.95
IGL01411:Hsd17b4 APN 18 50191814 missense probably damaging 1.00
IGL01986:Hsd17b4 APN 18 50160126 splice site probably benign
IGL02126:Hsd17b4 APN 18 50181996 missense probably benign
IGL02496:Hsd17b4 APN 18 50155153 missense probably damaging 0.97
IGL02527:Hsd17b4 APN 18 50160164 missense probably benign 0.00
IGL02553:Hsd17b4 APN 18 50162097 splice site probably benign
IGL02813:Hsd17b4 APN 18 50128348 utr 5 prime probably benign
I0000:Hsd17b4 UTSW 18 50160228 missense probably benign 0.09
IGL02980:Hsd17b4 UTSW 18 50146518 missense probably benign 0.06
R0352:Hsd17b4 UTSW 18 50191784 missense probably benign
R0734:Hsd17b4 UTSW 18 50170777 missense possibly damaging 0.90
R0967:Hsd17b4 UTSW 18 50183261 missense probably benign 0.00
R1418:Hsd17b4 UTSW 18 50130187 splice site probably benign
R1661:Hsd17b4 UTSW 18 50160215 missense probably benign
R1665:Hsd17b4 UTSW 18 50160215 missense probably benign
R1752:Hsd17b4 UTSW 18 50170767 missense probably benign 0.27
R1804:Hsd17b4 UTSW 18 50177984 missense probably damaging 1.00
R2197:Hsd17b4 UTSW 18 50183302 splice site probably null
R4351:Hsd17b4 UTSW 18 50142634 missense probably damaging 1.00
R4405:Hsd17b4 UTSW 18 50128314 start gained probably benign
R4976:Hsd17b4 UTSW 18 50160135 missense probably damaging 1.00
R5788:Hsd17b4 UTSW 18 50173709 missense probably damaging 0.99
R5826:Hsd17b4 UTSW 18 50183172 missense probably benign 0.00
R6475:Hsd17b4 UTSW 18 50172262 intron probably null
R6632:Hsd17b4 UTSW 18 50179102 missense possibly damaging 0.70
R7151:Hsd17b4 UTSW 18 50128370 missense probably damaging 1.00
R7367:Hsd17b4 UTSW 18 50155185 missense probably damaging 1.00
R7383:Hsd17b4 UTSW 18 50164850 missense probably benign 0.13
R7397:Hsd17b4 UTSW 18 50146424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAGGGAATTGCAGGTAATCTTG -3'
(R):5'- CCAGAGCCATATAGCGTTTTCTG -3'

Sequencing Primer
(F):5'- GTTTTAATCGGTAGCTGGC -3'
(R):5'- GAGCCATATAGCGTTTTCTGAATAC -3'
Posted On2017-02-15