Incidental Mutation 'R5900:Abcc12'
ID456271
Institutional Source Beutler Lab
Gene Symbol Abcc12
Ensembl Gene ENSMUSG00000036872
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 12
Synonyms4930467B22Rik, MRP9
MMRRC Submission 044099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5900 (G1)
Quality Score216
Status Not validated
Chromosome8
Chromosomal Location86482260-86580686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86566520 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 13 (D13G)
Ref Sequence ENSEMBL: ENSMUSP00000116866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080115] [ENSMUST00000129898] [ENSMUST00000131423] [ENSMUST00000131806] [ENSMUST00000152438] [ENSMUST00000156610]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080115
AA Change: D13G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079014
Gene: ENSMUSG00000036872
AA Change: D13G

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 3.6e-19 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Pfam:ABC_membrane 791 1079 1.3e-26 PFAM
AAA 1153 1346 1.07e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000129898
AA Change: D13G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122577
Gene: ENSMUSG00000036872
AA Change: D13G

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.2e-19 PFAM
AAA 506 679 3.33e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131423
AA Change: D13G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122402
Gene: ENSMUSG00000036872
AA Change: D13G

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.1e-21 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Pfam:ABC_membrane 792 1077 1.6e-34 PFAM
AAA 1153 1346 1.07e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131806
AA Change: D13G

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116866
Gene: ENSMUSG00000036872
AA Change: D13G

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.3e-19 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152438
AA Change: D13G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114582
Gene: ENSMUSG00000036872
AA Change: D13G

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.2e-19 PFAM
AAA 506 679 3.33e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000156610
AA Change: D13G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123578
Gene: ENSMUSG00000036872
AA Change: D13G

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 5.9e-20 PFAM
AAA 506 661 1.07e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two ATP-binding domains and 12 transmembrane regions. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies: ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White. This gene is a member of the MRP subfamily which is involved in multi-drug resistance. This gene and another subfamily member are arranged head-to-tail on chromosome 16q12.1. Increased expression of this gene is associated with breast cancer. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,279,156 T1341S possibly damaging Het
Adam24 T C 8: 40,681,032 V513A probably benign Het
Adgrg6 C T 10: 14,438,419 probably null Het
Ankrd11 T C 8: 122,891,066 T1995A probably benign Het
Apoh G T 11: 108,412,017 K269N probably damaging Het
Bahcc1 C T 11: 120,284,493 L1798F probably damaging Het
Brca2 T A 5: 150,541,132 C1454S probably benign Het
Clip2 T C 5: 134,502,779 D689G possibly damaging Het
Cpa5 T C 6: 30,615,116 V84A probably damaging Het
Ctsh T C 9: 90,064,568 I116T probably damaging Het
Dlg5 T A 14: 24,149,447 E1463V probably damaging Het
Dnah11 C T 12: 118,082,431 probably null Het
Dstyk G A 1: 132,456,979 R737Q probably damaging Het
Galr1 A G 18: 82,393,857 S295P probably damaging Het
Gpx2 A G 12: 76,792,879 V115A probably damaging Het
Hhipl2 A G 1: 183,426,689 I219V possibly damaging Het
Hkdc1 T C 10: 62,408,666 M214V possibly damaging Het
Lrfn2 T C 17: 49,070,263 V124A possibly damaging Het
Lrrcc1 T G 3: 14,562,126 S704R possibly damaging Het
Marveld2 T C 13: 100,611,668 Y301C probably damaging Het
Mcpt8 T C 14: 56,082,283 I237V probably damaging Het
Mtus1 A T 8: 41,083,497 V394D possibly damaging Het
Ncapd3 T A 9: 27,066,969 D821E probably benign Het
Pcdh9 T C 14: 93,326,720 D1058G probably damaging Het
Pld2 G A 11: 70,556,062 probably null Het
Prdm2 A G 4: 143,134,720 S667P probably damaging Het
Ptgdr2 A T 19: 10,940,988 probably null Het
Rfx7 C T 9: 72,617,256 T576I probably benign Het
Safb T C 17: 56,600,349 C426R unknown Het
Serpina9 G A 12: 104,008,871 R8* probably null Het
Shank3 G A 15: 89,503,390 R254Q probably damaging Het
Simc1 T C 13: 54,547,024 V306A probably damaging Het
Srfbp1 A G 18: 52,488,781 T305A probably benign Het
Tdrd5 A T 1: 156,277,435 C463* probably null Het
Tmem132d A T 5: 128,269,272 L62Q probably damaging Het
Trank1 T A 9: 111,391,716 L2507H probably damaging Het
Usp45 T C 4: 21,830,451 V702A probably damaging Het
Wnk2 A G 13: 49,102,832 I271T probably damaging Het
Zfp292 A T 4: 34,805,125 L2640I probably damaging Het
Znrf3 G T 11: 5,282,110 H468N probably damaging Het
Other mutations in Abcc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Abcc12 APN 8 86534693 missense probably benign 0.45
IGL01504:Abcc12 APN 8 86557602 missense probably damaging 1.00
IGL01593:Abcc12 APN 8 86557650 missense probably damaging 1.00
IGL02164:Abcc12 APN 8 86527404 missense probably damaging 1.00
IGL02173:Abcc12 APN 8 86566442 missense probably damaging 1.00
IGL02175:Abcc12 APN 8 86535013 splice site probably null
IGL02405:Abcc12 APN 8 86558153 missense probably damaging 0.98
IGL02620:Abcc12 APN 8 86505314 splice site probably null
IGL02635:Abcc12 APN 8 86509682 splice site probably benign
IGL03241:Abcc12 APN 8 86509807 missense possibly damaging 0.77
PIT4544001:Abcc12 UTSW 8 86505246 missense possibly damaging 0.58
R0023:Abcc12 UTSW 8 86538333 missense probably damaging 1.00
R0023:Abcc12 UTSW 8 86538333 missense probably damaging 1.00
R0116:Abcc12 UTSW 8 86534998 missense probably benign 0.00
R0131:Abcc12 UTSW 8 86531568 missense probably benign
R0131:Abcc12 UTSW 8 86531568 missense probably benign
R0132:Abcc12 UTSW 8 86531568 missense probably benign
R0308:Abcc12 UTSW 8 86557752 splice site probably benign
R0589:Abcc12 UTSW 8 86560472 missense possibly damaging 0.86
R1451:Abcc12 UTSW 8 86557693 missense probably damaging 1.00
R1564:Abcc12 UTSW 8 86517486 missense probably benign 0.10
R1740:Abcc12 UTSW 8 86505497 nonsense probably null
R1740:Abcc12 UTSW 8 86509771 missense possibly damaging 0.78
R1970:Abcc12 UTSW 8 86527281 missense probably benign 0.27
R2017:Abcc12 UTSW 8 86563988 missense probably damaging 1.00
R2026:Abcc12 UTSW 8 86558233 missense probably benign 0.30
R2402:Abcc12 UTSW 8 86509141 missense probably damaging 1.00
R3085:Abcc12 UTSW 8 86543907 splice site probably benign
R3115:Abcc12 UTSW 8 86540024 critical splice donor site probably null
R3176:Abcc12 UTSW 8 86506866 missense probably damaging 1.00
R3276:Abcc12 UTSW 8 86506866 missense probably damaging 1.00
R3847:Abcc12 UTSW 8 86553391 missense probably benign 0.05
R3911:Abcc12 UTSW 8 86528419 splice site probably benign
R4031:Abcc12 UTSW 8 86517448 missense probably damaging 1.00
R4297:Abcc12 UTSW 8 86531525 splice site probably null
R4298:Abcc12 UTSW 8 86531525 splice site probably null
R4299:Abcc12 UTSW 8 86531525 splice site probably null
R4688:Abcc12 UTSW 8 86548694 missense possibly damaging 0.46
R4810:Abcc12 UTSW 8 86560842 missense probably damaging 1.00
R4863:Abcc12 UTSW 8 86538376 missense probably damaging 1.00
R4892:Abcc12 UTSW 8 86509802 missense probably benign 0.28
R5288:Abcc12 UTSW 8 86566539 missense probably damaging 1.00
R5303:Abcc12 UTSW 8 86509786 missense probably benign 0.15
R5332:Abcc12 UTSW 8 86524830 splice site probably null
R5386:Abcc12 UTSW 8 86517489 missense possibly damaging 0.82
R5457:Abcc12 UTSW 8 86509844 missense probably benign 0.03
R6035:Abcc12 UTSW 8 86517404 missense probably damaging 0.98
R6035:Abcc12 UTSW 8 86517404 missense probably damaging 0.98
R6291:Abcc12 UTSW 8 86566544 missense possibly damaging 0.72
R6518:Abcc12 UTSW 8 86509089
R6677:Abcc12 UTSW 8 86534752 missense possibly damaging 0.58
R7258:Abcc12 UTSW 8 86560857 missense possibly damaging 0.94
X0027:Abcc12 UTSW 8 86553291 missense probably damaging 0.99
Z1088:Abcc12 UTSW 8 86560279 synonymous probably null
Predicted Primers PCR Primer
(F):5'- ACATACGGAGCAGTACCTTGC -3'
(R):5'- TGCCTCAAATACAGGTTAAGGGG -3'

Sequencing Primer
(F):5'- AGCAGTACCTTGCGAGCAG -3'
(R):5'- TGTCCAAGGGCTCAAAGC -3'
Posted On2017-02-15