Incidental Mutation 'R5900:Hkdc1'
ID456280
Institutional Source Beutler Lab
Gene Symbol Hkdc1
Ensembl Gene ENSMUSG00000020080
Gene Namehexokinase domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R5900 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62383137-62422491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62408666 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 214 (M214V)
Ref Sequence ENSEMBL: ENSMUSP00000020277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020277]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020277
AA Change: M214V

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020277
Gene: ENSMUSG00000020080
AA Change: M214V

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 3.3e-71 PFAM
Pfam:Hexokinase_2 225 459 5.6e-79 PFAM
Pfam:Hexokinase_1 469 665 9.5e-76 PFAM
Pfam:Hexokinase_2 670 904 5.1e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159454
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hexokinase protein family. The encoded protein is involved in glucose metabolism, and reduced expression may be associated with gestational diabetes mellitus. High expression of this gene may also be associated with poor prognosis in hepatocarcinoma. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality prior to genotyping. Mice heterozygous for a knock-out allele exhibit impaired glucose tolerance and female-specific increased in hepatic triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,279,156 T1341S possibly damaging Het
Abcc12 T C 8: 86,566,520 D13G possibly damaging Het
Adam24 T C 8: 40,681,032 V513A probably benign Het
Adgrg6 C T 10: 14,438,419 probably null Het
Ankrd11 T C 8: 122,891,066 T1995A probably benign Het
Apoh G T 11: 108,412,017 K269N probably damaging Het
Bahcc1 C T 11: 120,284,493 L1798F probably damaging Het
Brca2 T A 5: 150,541,132 C1454S probably benign Het
Clip2 T C 5: 134,502,779 D689G possibly damaging Het
Cpa5 T C 6: 30,615,116 V84A probably damaging Het
Ctsh T C 9: 90,064,568 I116T probably damaging Het
Dlg5 T A 14: 24,149,447 E1463V probably damaging Het
Dnah11 C T 12: 118,082,431 probably null Het
Dstyk G A 1: 132,456,979 R737Q probably damaging Het
Galr1 A G 18: 82,393,857 S295P probably damaging Het
Gpx2 A G 12: 76,792,879 V115A probably damaging Het
Hhipl2 A G 1: 183,426,689 I219V possibly damaging Het
Lrfn2 T C 17: 49,070,263 V124A possibly damaging Het
Lrrcc1 T G 3: 14,562,126 S704R possibly damaging Het
Marveld2 T C 13: 100,611,668 Y301C probably damaging Het
Mcpt8 T C 14: 56,082,283 I237V probably damaging Het
Mtus1 A T 8: 41,083,497 V394D possibly damaging Het
Ncapd3 T A 9: 27,066,969 D821E probably benign Het
Pcdh9 T C 14: 93,326,720 D1058G probably damaging Het
Pld2 G A 11: 70,556,062 probably null Het
Prdm2 A G 4: 143,134,720 S667P probably damaging Het
Ptgdr2 A T 19: 10,940,988 probably null Het
Rfx7 C T 9: 72,617,256 T576I probably benign Het
Safb T C 17: 56,600,349 C426R unknown Het
Serpina9 G A 12: 104,008,871 R8* probably null Het
Shank3 G A 15: 89,503,390 R254Q probably damaging Het
Simc1 T C 13: 54,547,024 V306A probably damaging Het
Srfbp1 A G 18: 52,488,781 T305A probably benign Het
Tdrd5 A T 1: 156,277,435 C463* probably null Het
Tmem132d A T 5: 128,269,272 L62Q probably damaging Het
Trank1 T A 9: 111,391,716 L2507H probably damaging Het
Usp45 T C 4: 21,830,451 V702A probably damaging Het
Wnk2 A G 13: 49,102,832 I271T probably damaging Het
Zfp292 A T 4: 34,805,125 L2640I probably damaging Het
Znrf3 G T 11: 5,282,110 H468N probably damaging Het
Other mutations in Hkdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Hkdc1 APN 10 62393789 missense probably damaging 0.99
IGL01300:Hkdc1 APN 10 62395261 splice site probably benign
IGL01415:Hkdc1 APN 10 62393859 missense probably damaging 1.00
IGL01935:Hkdc1 APN 10 62400386 missense probably damaging 0.97
IGL02903:Hkdc1 APN 10 62400191 critical splice donor site probably null
IGL03100:Hkdc1 APN 10 62417829 missense probably benign 0.00
IGL03154:Hkdc1 APN 10 62385705 missense probably damaging 1.00
R0368:Hkdc1 UTSW 10 62411707 missense probably null 0.04
R0549:Hkdc1 UTSW 10 62400240 missense probably benign
R0667:Hkdc1 UTSW 10 62411865 splice site probably benign
R0751:Hkdc1 UTSW 10 62398673 missense probably damaging 0.99
R1779:Hkdc1 UTSW 10 62391383 missense probably damaging 1.00
R1929:Hkdc1 UTSW 10 62417898 missense probably benign 0.01
R2271:Hkdc1 UTSW 10 62417898 missense probably benign 0.01
R3831:Hkdc1 UTSW 10 62400212 missense probably benign
R4480:Hkdc1 UTSW 10 62391372 missense probably benign
R4561:Hkdc1 UTSW 10 62409839 missense probably benign 0.00
R4576:Hkdc1 UTSW 10 62385843 missense possibly damaging 0.56
R4655:Hkdc1 UTSW 10 62400463 missense probably benign 0.09
R4723:Hkdc1 UTSW 10 62400354 missense probably benign 0.00
R4810:Hkdc1 UTSW 10 62411525 missense probably benign 0.08
R5086:Hkdc1 UTSW 10 62395274 intron probably benign
R5138:Hkdc1 UTSW 10 62398691 missense probably damaging 1.00
R5781:Hkdc1 UTSW 10 62417933 missense probably damaging 0.98
R5982:Hkdc1 UTSW 10 62393810 missense probably benign
R6418:Hkdc1 UTSW 10 62383804 missense possibly damaging 0.93
R6463:Hkdc1 UTSW 10 62393702 missense probably damaging 1.00
R6612:Hkdc1 UTSW 10 62395441 missense possibly damaging 0.48
R6673:Hkdc1 UTSW 10 62403606 missense probably damaging 0.99
R6761:Hkdc1 UTSW 10 62408698 missense possibly damaging 0.93
R6915:Hkdc1 UTSW 10 62401932 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGATGCAGGCTTCGCATCTC -3'
(R):5'- TCACAGCAGTCATTCCCTCAG -3'

Sequencing Primer
(F):5'- CCCCGTGTTGCTCTGCAG -3'
(R):5'- GTCATTCCCTCAGCGCAGAAG -3'
Posted On2017-02-15