Incidental Mutation 'R5900:Serpina9'
ID456288
Institutional Source Beutler Lab
Gene Symbol Serpina9
Ensembl Gene ENSMUSG00000058260
Gene Nameserine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9
SynonymsCenterin, 2310014L03Rik
MMRRC Submission 044099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R5900 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location103994743-104013755 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 104008871 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 8 (R8*)
Ref Sequence ENSEMBL: ENSMUSP00000130064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058464] [ENSMUST00000164023]
Predicted Effect probably null
Transcript: ENSMUST00000058464
AA Change: R8*
SMART Domains Protein: ENSMUSP00000058535
Gene: ENSMUSG00000058260
AA Change: R8*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 55 415 1.27e-158 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164023
AA Change: R8*
SMART Domains Protein: ENSMUSP00000130064
Gene: ENSMUSG00000058260
AA Change: R8*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 55 205 8.9e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,279,156 T1341S possibly damaging Het
Abcc12 T C 8: 86,566,520 D13G possibly damaging Het
Adam24 T C 8: 40,681,032 V513A probably benign Het
Adgrg6 C T 10: 14,438,419 probably null Het
Ankrd11 T C 8: 122,891,066 T1995A probably benign Het
Apoh G T 11: 108,412,017 K269N probably damaging Het
Bahcc1 C T 11: 120,284,493 L1798F probably damaging Het
Brca2 T A 5: 150,541,132 C1454S probably benign Het
Clip2 T C 5: 134,502,779 D689G possibly damaging Het
Cpa5 T C 6: 30,615,116 V84A probably damaging Het
Ctsh T C 9: 90,064,568 I116T probably damaging Het
Dlg5 T A 14: 24,149,447 E1463V probably damaging Het
Dnah11 C T 12: 118,082,431 probably null Het
Dstyk G A 1: 132,456,979 R737Q probably damaging Het
Galr1 A G 18: 82,393,857 S295P probably damaging Het
Gpx2 A G 12: 76,792,879 V115A probably damaging Het
Hhipl2 A G 1: 183,426,689 I219V possibly damaging Het
Hkdc1 T C 10: 62,408,666 M214V possibly damaging Het
Lrfn2 T C 17: 49,070,263 V124A possibly damaging Het
Lrrcc1 T G 3: 14,562,126 S704R possibly damaging Het
Marveld2 T C 13: 100,611,668 Y301C probably damaging Het
Mcpt8 T C 14: 56,082,283 I237V probably damaging Het
Mtus1 A T 8: 41,083,497 V394D possibly damaging Het
Ncapd3 T A 9: 27,066,969 D821E probably benign Het
Pcdh9 T C 14: 93,326,720 D1058G probably damaging Het
Pld2 G A 11: 70,556,062 probably null Het
Prdm2 A G 4: 143,134,720 S667P probably damaging Het
Ptgdr2 A T 19: 10,940,988 probably null Het
Rfx7 C T 9: 72,617,256 T576I probably benign Het
Safb T C 17: 56,600,349 C426R unknown Het
Shank3 G A 15: 89,503,390 R254Q probably damaging Het
Simc1 T C 13: 54,547,024 V306A probably damaging Het
Srfbp1 A G 18: 52,488,781 T305A probably benign Het
Tdrd5 A T 1: 156,277,435 C463* probably null Het
Tmem132d A T 5: 128,269,272 L62Q probably damaging Het
Trank1 T A 9: 111,391,716 L2507H probably damaging Het
Usp45 T C 4: 21,830,451 V702A probably damaging Het
Wnk2 A G 13: 49,102,832 I271T probably damaging Het
Zfp292 A T 4: 34,805,125 L2640I probably damaging Het
Znrf3 G T 11: 5,282,110 H468N probably damaging Het
Other mutations in Serpina9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Serpina9 APN 12 104008586 missense probably damaging 1.00
IGL02228:Serpina9 APN 12 104008600 missense probably benign 0.02
IGL02692:Serpina9 APN 12 104008406 missense probably damaging 1.00
IGL03149:Serpina9 APN 12 104008610 nonsense probably null
IGL03134:Serpina9 UTSW 12 104001437 missense probably null 0.18
R0119:Serpina9 UTSW 12 104001470 missense probably benign 0.18
R0299:Serpina9 UTSW 12 104001470 missense probably benign 0.18
R0499:Serpina9 UTSW 12 104001470 missense probably benign 0.18
R1477:Serpina9 UTSW 12 103997103 missense possibly damaging 0.90
R1912:Serpina9 UTSW 12 104001249 missense probably damaging 1.00
R2142:Serpina9 UTSW 12 104008309 missense probably benign 0.04
R2221:Serpina9 UTSW 12 103998264 missense probably damaging 0.98
R2413:Serpina9 UTSW 12 104001226 critical splice donor site probably null
R3939:Serpina9 UTSW 12 104008892 start codon destroyed probably benign 0.01
R4515:Serpina9 UTSW 12 104001294 missense probably benign 0.14
R5242:Serpina9 UTSW 12 104008385 missense probably benign 0.09
R5589:Serpina9 UTSW 12 104001469 missense probably benign 0.00
R6171:Serpina9 UTSW 12 104008419 nonsense probably null
R6195:Serpina9 UTSW 12 104001407 missense probably damaging 0.96
R6566:Serpina9 UTSW 12 103997037 missense possibly damaging 0.61
R6995:Serpina9 UTSW 12 104001236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCTGGGTTTTCCTGAGC -3'
(R):5'- TATCCCAGTTAGCATCAGCCTC -3'

Sequencing Primer
(F):5'- TGGGTTTTCCTGAGCCAGCC -3'
(R):5'- TGTGACCCATGCCAAGTTAC -3'
Posted On2017-02-15