Incidental Mutation 'R5902:Dspp'
ID456373
Institutional Source Beutler Lab
Gene Symbol Dspp
Ensembl Gene ENSMUSG00000053268
Gene Namedentin sialophosphoprotein
SynonymsDmp3, Dsp, Dpp
MMRRC Submission 044100-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5902 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location104170712-104180127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104178111 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 780 (D780V)
Ref Sequence ENSEMBL: ENSMUSP00000108391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112771]
Predicted Effect unknown
Transcript: ENSMUST00000112771
AA Change: D780V
SMART Domains Protein: ENSMUSP00000108391
Gene: ENSMUSG00000053268
AA Change: D780V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
internal_repeat_1 82 245 2.01e-11 PROSPERO
low complexity region 247 268 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
internal_repeat_1 285 438 2.01e-11 PROSPERO
internal_repeat_2 286 369 2.15e-10 PROSPERO
internal_repeat_2 370 454 2.15e-10 PROSPERO
low complexity region 456 472 N/A INTRINSIC
low complexity region 481 944 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.1%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: This gene encodes a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING) family of proteins. The encoded preproprotein is secreted by odontoblasts and proteolytically processed to generate two principal proteins of the dentin extracellular matrix of the tooth, dentin sialoprotein and dentin phosphoprotein. These two protein products may play distinct but related roles in dentin mineralization. Mice lacking the encoded protein exhibit hypomineralization defects in dentin, similar to human dentinogenesis imperfecta. [provided by RefSeq, Feb 2016]
PHENOTYPE: Aging mice homozygous for a reporter/null allele display tooth abnormalities, including enlarged pulp cavities, a widened predentin zone, dentin hypomineralization, pulp exposure, and occasional brittle incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,708,937 M1V probably null Het
Abca13 T A 11: 9,297,177 L2308H probably damaging Het
Abcc8 T C 7: 46,115,039 T1161A probably benign Het
Acin1 T A 14: 54,663,673 T659S probably benign Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Alkbh8 A G 9: 3,385,414 K569E probably benign Het
Anxa3 A T 5: 96,812,853 K39* probably null Het
Aoc2 A G 11: 101,329,246 E659G probably damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
AU022252 T C 4: 119,226,904 D104G probably benign Het
Car6 T C 4: 150,187,499 Y231C possibly damaging Het
Ccdc94 A G 17: 55,962,077 T62A probably damaging Het
Cdh10 T G 15: 18,985,255 probably null Het
Cebpz A C 17: 78,925,937 M787R probably benign Het
Chst2 A G 9: 95,405,609 L228P probably damaging Het
Clic4 T C 4: 135,272,558 K11R probably benign Het
Col6a3 C T 1: 90,802,199 probably null Het
Commd7 T A 2: 153,621,817 T144S probably damaging Het
Ctla2a T A 13: 60,935,020 *138Y probably null Het
Dhx33 A T 11: 70,989,131 V351D probably damaging Het
Dnah9 G A 11: 66,025,187 T2313I probably benign Het
Dync1li1 A G 9: 114,717,861 probably null Het
E2f3 C T 13: 29,985,267 probably benign Het
Fan1 T C 7: 64,373,322 probably null Het
Gart A G 16: 91,628,527 S617P probably damaging Het
Ggcx A G 6: 72,429,996 N705S possibly damaging Het
Gm4841 A T 18: 60,270,796 V75E probably damaging Het
Greb1l A G 18: 10,538,302 E1105G probably benign Het
Hr C A 14: 70,557,791 Q288K probably benign Het
Hus1 T C 11: 9,010,669 probably benign Het
Ifi47 C A 11: 49,095,386 probably null Het
Irf2bp1 T C 7: 19,004,447 V4A probably benign Het
Kprp C T 3: 92,824,528 C405Y unknown Het
Lacc1 T C 14: 77,034,799 I186V possibly damaging Het
Lifr A G 15: 7,190,750 T954A probably benign Het
Lonrf2 T C 1: 38,807,093 M333V probably benign Het
Mthfd1 A T 12: 76,291,052 H400L probably benign Het
Myh4 A G 11: 67,250,907 K864R possibly damaging Het
Nup50 C T 15: 84,935,440 A305V probably benign Het
Olfr1247 T A 2: 89,609,251 I284L probably damaging Het
Olfr1294 C T 2: 111,537,394 M298I probably benign Het
Pax4 G T 6: 28,447,127 Q3K probably benign Het
Pced1b T G 15: 97,385,089 Y336* probably null Het
Postn C A 3: 54,372,089 N329K probably benign Het
Prickle1 T C 15: 93,510,672 E82G probably null Het
Prtn3 T C 10: 79,882,932 Y241H probably damaging Het
Rasgrf2 A T 13: 91,919,892 I260K probably damaging Het
Sh3glb1 T C 3: 144,712,670 N44S possibly damaging Het
Sis A T 3: 72,960,256 probably null Het
Slc4a9 A G 18: 36,529,333 probably null Het
Slc4a9 A T 18: 36,531,507 D406V probably damaging Het
Slc8a1 C T 17: 81,408,082 G841R probably damaging Het
Smn1 C T 13: 100,126,904 P60L probably benign Het
Snai1 G A 2: 167,542,010 C241Y probably damaging Het
Spock3 A G 8: 63,355,302 D411G unknown Het
Szt2 T A 4: 118,391,503 T607S probably benign Het
Tcap A T 11: 98,383,847 M1L probably benign Het
Tex29 C A 8: 11,854,276 probably benign Het
Tex29 C T 8: 11,854,277 probably benign Het
Tex29 A T 8: 11,855,723 probably benign Het
Tln2 T C 9: 67,362,717 T467A probably benign Het
Trim34a C T 7: 104,261,121 Q377* probably null Het
Ube2q1 T A 3: 89,776,180 L144* probably null Het
Vps13c A G 9: 67,934,447 E1917G probably benign Het
Wdr19 T A 5: 65,227,139 N525K probably benign Het
Wdr3 A T 3: 100,144,491 probably benign Het
Wnt5b T A 6: 119,448,238 H6L probably benign Het
Zdbf2 T C 1: 63,306,526 S1355P possibly damaging Het
Zfp11 T A 5: 129,657,912 I162F probably damaging Het
Zpbp T C 11: 11,415,332 T172A probably benign Het
Other mutations in Dspp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Dspp APN 5 104176892 missense possibly damaging 0.95
IGL01096:Dspp APN 5 104175367 missense possibly damaging 0.92
IGL01317:Dspp APN 5 104174048 missense probably damaging 0.99
IGL02365:Dspp APN 5 104176061 missense probably damaging 1.00
IGL02387:Dspp APN 5 104175624 missense possibly damaging 0.82
IGL02406:Dspp APN 5 104177366 nonsense probably null
IGL02445:Dspp APN 5 104177097 missense probably damaging 0.99
IGL02481:Dspp APN 5 104175648 missense possibly damaging 0.94
IGL02536:Dspp APN 5 104175665 missense probably damaging 0.99
IGL02572:Dspp APN 5 104177069 missense probably damaging 0.99
IGL02677:Dspp APN 5 104175977 missense possibly damaging 0.78
IGL02709:Dspp APN 5 104177250 missense unknown
IGL02723:Dspp APN 5 104175175 missense probably benign 0.03
IGL02740:Dspp APN 5 104177238 nonsense probably null
IGL03274:Dspp APN 5 104174948 missense probably damaging 0.99
IGL03293:Dspp APN 5 104177561 missense unknown
FR4449:Dspp UTSW 5 104178388 small deletion probably benign
R0018:Dspp UTSW 5 104178230 missense unknown
R0125:Dspp UTSW 5 104178039 missense unknown
R0503:Dspp UTSW 5 104177256 missense unknown
R1709:Dspp UTSW 5 104175724 missense probably damaging 0.98
R1851:Dspp UTSW 5 104174085 critical splice donor site probably null
R2001:Dspp UTSW 5 104178559 missense unknown
R2002:Dspp UTSW 5 104178559 missense unknown
R2198:Dspp UTSW 5 104175701 missense probably benign 0.37
R2279:Dspp UTSW 5 104178384 missense unknown
R4026:Dspp UTSW 5 104177697 missense unknown
R4066:Dspp UTSW 5 104177194 missense unknown
R4632:Dspp UTSW 5 104177406 missense unknown
R4693:Dspp UTSW 5 104178062 missense unknown
R4841:Dspp UTSW 5 104177186 missense unknown
R4841:Dspp UTSW 5 104177187 missense unknown
R4917:Dspp UTSW 5 104177923 missense unknown
R5008:Dspp UTSW 5 104175573 missense possibly damaging 0.66
R5015:Dspp UTSW 5 104177060 missense possibly damaging 0.46
R5214:Dspp UTSW 5 104178498 missense unknown
R5359:Dspp UTSW 5 104175886 missense probably damaging 0.98
R5538:Dspp UTSW 5 104175230 nonsense probably null
R5703:Dspp UTSW 5 104177051 missense possibly damaging 0.82
R5887:Dspp UTSW 5 104175455 missense probably damaging 1.00
R5992:Dspp UTSW 5 104178451 missense unknown
R6019:Dspp UTSW 5 104178039 missense unknown
R6191:Dspp UTSW 5 104177348 missense unknown
R6362:Dspp UTSW 5 104176034 missense probably benign 0.19
R6736:Dspp UTSW 5 104178175 missense unknown
R6805:Dspp UTSW 5 104175850 missense probably benign 0.03
R7064:Dspp UTSW 5 104176938 missense possibly damaging 0.73
R7178:Dspp UTSW 5 104174066 missense probably benign 0.02
R7243:Dspp UTSW 5 104178361 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GTAGTGACAGCAGTGACAGC -3'
(R):5'- TGTCAGAACTGCTATCCTTGC -3'

Sequencing Primer
(F):5'- TGACAGCAGCAACAGTAGTGAC -3'
(R):5'- AGAACTGCTATCCTTGCTGTCACTG -3'
Posted On2017-02-15