Incidental Mutation 'R5905:Marf1'
ID456559
Institutional Source Beutler Lab
Gene Symbol Marf1
Ensembl Gene ENSMUSG00000060657
Gene Namemeiosis regulator and mRNA stability 1
Synonyms4921513D23Rik
MMRRC Submission 044102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R5905 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location14109173-14163351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14127249 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1252 (Q1252L)
Ref Sequence ENSEMBL: ENSMUSP00000087770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090300]
Predicted Effect probably damaging
Transcript: ENSMUST00000090300
AA Change: Q1252L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087770
Gene: ENSMUSG00000060657
AA Change: Q1252L

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
Pfam:NYN 351 492 1.5e-21 PFAM
RRM 511 579 3.17e-1 SMART
low complexity region 599 610 N/A INTRINSIC
RRM 790 864 4.47e-3 SMART
internal_repeat_2 871 914 1.57e-5 PROSPERO
low complexity region 944 960 N/A INTRINSIC
Pfam:OST-HTH 1096 1167 1e-11 PFAM
low complexity region 1181 1186 N/A INTRINSIC
Pfam:OST-HTH 1256 1328 1.2e-10 PFAM
Pfam:OST-HTH 1332 1404 2.4e-10 PFAM
Pfam:OST-HTH 1408 1480 6.8e-13 PFAM
Pfam:OST-HTH 1483 1555 3e-14 PFAM
low complexity region 1682 1701 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183739
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative peroxisomal protein that appears to be conserved across Euteleostomi. In humans, it may be autoantigenic. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit female infertility with abnormalities in oogenic processes including meiotic progression, genomic integrity and acquisition of developmental competence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Als2cl G T 9: 110,898,084 R906L probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arf4 A G 14: 26,653,924 T113A probably benign Het
Arhgap8 A T 15: 84,741,977 K84N possibly damaging Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Catsperb T A 12: 101,602,700 M877K possibly damaging Het
Cc2d2a A T 5: 43,712,426 M890L probably benign Het
Cd180 A T 13: 102,706,033 H529L possibly damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Chd7 C A 4: 8,840,553 N1440K possibly damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dmap1 G T 4: 117,676,766 T132K probably benign Het
Dnah11 C T 12: 117,954,924 G3424E probably damaging Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Egfr A T 11: 16,911,494 E1091V probably damaging Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
F2r A G 13: 95,604,613 V138A possibly damaging Het
Faf1 T A 4: 109,890,929 M477K probably benign Het
Fam149b C T 14: 20,359,910 T235M probably benign Het
Fan1 C A 7: 64,353,651 A808S probably benign Het
Fbxl20 A G 11: 98,115,445 I38T probably damaging Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm884 A T 11: 103,614,255 S2296T probably damaging Het
Gm9747 T C 1: 82,234,298 probably benign Het
Grip1 A G 10: 119,985,492 D354G probably benign Het
Grk4 A C 5: 34,711,730 Y189S probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hgfac A G 5: 35,042,362 N63D probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Hrc G A 7: 45,336,234 G270S probably damaging Het
Inhba T A 13: 16,017,308 W5R probably benign Het
Lipm T C 19: 34,111,911 S90P probably benign Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmod3 T A 6: 97,247,614 E415D probably damaging Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Map9 T A 3: 82,380,248 probably null Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Mepce A G 5: 137,784,720 V448A possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr12 T A 1: 92,620,142 C79S possibly damaging Het
Olfr625-ps1 T A 7: 103,683,574 N285K probably damaging Het
Olfr689 T C 7: 105,314,951 Y316H probably benign Het
Olfr763 A T 10: 129,011,287 M1L probably benign Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Otoa T A 7: 121,094,601 L68Q probably damaging Het
Pclo A T 5: 14,680,385 probably benign Het
Pcsk2 T A 2: 143,749,140 Y186N probably damaging Het
Pigz A G 16: 31,945,428 T435A probably benign Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prss36 T C 7: 127,933,572 D716G probably benign Het
Rapgef5 T A 12: 117,748,426 D547E probably damaging Het
Slc4a11 T A 2: 130,685,052 I719F probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Snrpb T A 2: 130,179,276 probably benign Het
Sox9 A G 11: 112,783,820 E148G probably damaging Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Syt17 T C 7: 118,436,918 D74G probably benign Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Trrap A G 5: 144,849,920 K3170R possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Vmn1r216 C T 13: 23,099,197 L17F probably damaging Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Marf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Marf1 APN 16 14115742 missense possibly damaging 0.49
IGL00933:Marf1 APN 16 14117357 missense probably damaging 1.00
IGL01101:Marf1 APN 16 14146736 missense possibly damaging 0.85
IGL02140:Marf1 APN 16 14141912 missense probably damaging 0.99
IGL03196:Marf1 APN 16 14140259 missense possibly damaging 0.64
PIT4283001:Marf1 UTSW 16 14128568 missense probably benign 0.22
R0016:Marf1 UTSW 16 14152265 missense probably damaging 0.99
R0016:Marf1 UTSW 16 14152265 missense probably damaging 0.99
R0046:Marf1 UTSW 16 14111727 missense possibly damaging 0.83
R0046:Marf1 UTSW 16 14111727 missense possibly damaging 0.83
R0056:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0057:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0058:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0058:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0113:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0115:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0179:Marf1 UTSW 16 14151176 missense probably damaging 1.00
R0238:Marf1 UTSW 16 14151283 missense probably benign 0.00
R0238:Marf1 UTSW 16 14151283 missense probably benign 0.00
R0294:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0295:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0316:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0318:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0375:Marf1 UTSW 16 14151320 splice site probably benign
R0383:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0391:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0504:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0589:Marf1 UTSW 16 14142055 splice site probably benign
R0603:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0610:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R1240:Marf1 UTSW 16 14146762 missense possibly damaging 0.48
R1445:Marf1 UTSW 16 14115824 missense probably benign
R1716:Marf1 UTSW 16 14142586 missense possibly damaging 0.95
R1921:Marf1 UTSW 16 14128601 missense possibly damaging 0.63
R2098:Marf1 UTSW 16 14114200 missense probably benign 0.00
R2155:Marf1 UTSW 16 14132429 missense probably damaging 0.99
R2177:Marf1 UTSW 16 14152607 missense probably benign 0.01
R2195:Marf1 UTSW 16 14111699 missense probably benign
R2410:Marf1 UTSW 16 14115827 missense probably benign 0.02
R2999:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R3000:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R3147:Marf1 UTSW 16 14125979 missense possibly damaging 0.64
R3148:Marf1 UTSW 16 14125979 missense possibly damaging 0.64
R3430:Marf1 UTSW 16 14140177 unclassified probably benign
R3821:Marf1 UTSW 16 14142554 missense probably damaging 1.00
R4383:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R4384:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R4520:Marf1 UTSW 16 14132666 missense probably damaging 0.98
R4554:Marf1 UTSW 16 14153977 start gained probably benign
R4557:Marf1 UTSW 16 14153977 start gained probably benign
R4768:Marf1 UTSW 16 14131597 missense possibly damaging 0.93
R4784:Marf1 UTSW 16 14152457 missense probably benign
R4857:Marf1 UTSW 16 14128611 nonsense probably null
R4863:Marf1 UTSW 16 14132665 missense possibly damaging 0.60
R4994:Marf1 UTSW 16 14114231 missense probably benign
R5191:Marf1 UTSW 16 14146078 missense probably damaging 1.00
R5503:Marf1 UTSW 16 14152231 missense probably damaging 0.99
R5813:Marf1 UTSW 16 14152585 missense probably benign 0.35
R5960:Marf1 UTSW 16 14152417 missense probably damaging 0.98
R6104:Marf1 UTSW 16 14117455 missense probably damaging 0.99
R6387:Marf1 UTSW 16 14141640 makesense probably null
R6533:Marf1 UTSW 16 14115799 missense probably benign 0.16
R6608:Marf1 UTSW 16 14132714 missense probably damaging 1.00
R6642:Marf1 UTSW 16 14132747 missense probably benign 0.02
R6954:Marf1 UTSW 16 14138520 missense probably damaging 1.00
R6994:Marf1 UTSW 16 14128857 missense probably damaging 1.00
R7010:Marf1 UTSW 16 14137001 missense probably damaging 0.99
R7090:Marf1 UTSW 16 14111702 missense possibly damaging 0.52
R7174:Marf1 UTSW 16 14136953 missense probably damaging 1.00
R7221:Marf1 UTSW 16 14142485 missense probably damaging 1.00
R7247:Marf1 UTSW 16 14127093 missense probably damaging 1.00
U24488:Marf1 UTSW 16 14132366 nonsense probably null
X0025:Marf1 UTSW 16 14114278 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTATGGCTTCCAAAAGTTC -3'
(R):5'- TAGCACCCTTGTTTCCCAGG -3'

Sequencing Primer
(F):5'- CTTCCAAAAGTTCAAGCAGCTTGG -3'
(R):5'- CTTGAGCCTGTAGGAGAACCACTG -3'
Posted On2017-02-15