Incidental Mutation 'R5890:Mfsd4a'
ID457063
Institutional Source Beutler Lab
Gene Symbol Mfsd4a
Ensembl Gene ENSMUSG00000059149
Gene Namemajor facilitator superfamily domain containing 4A
SynonymsMfsd4, A930031D07Rik
MMRRC Submission 044091-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5890 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location132022806-132068062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132038928 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 356 (Y356C)
Ref Sequence ENSEMBL: ENSMUSP00000039635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046658] [ENSMUST00000112365] [ENSMUST00000112370] [ENSMUST00000126927] [ENSMUST00000144548] [ENSMUST00000146267] [ENSMUST00000159038] [ENSMUST00000160656] [ENSMUST00000161864]
Predicted Effect probably damaging
Transcript: ENSMUST00000046658
AA Change: Y356C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039635
Gene: ENSMUSG00000059149
AA Change: Y356C

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
transmembrane domain 55 74 N/A INTRINSIC
transmembrane domain 81 99 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 218 240 N/A INTRINSIC
transmembrane domain 245 267 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 309 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112365
SMART Domains Protein: ENSMUSP00000107984
Gene: ENSMUSG00000059149

DomainStartEndE-ValueType
Pfam:MFS_1 21 430 1.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112370
SMART Domains Protein: ENSMUSP00000107989
Gene: ENSMUSG00000059149

DomainStartEndE-ValueType
Pfam:MFS_1 21 405 1.1e-11 PFAM
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126927
SMART Domains Protein: ENSMUSP00000116706
Gene: ENSMUSG00000059149

DomainStartEndE-ValueType
Pfam:MFS_1 21 405 1.1e-11 PFAM
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144548
SMART Domains Protein: ENSMUSP00000116282
Gene: ENSMUSG00000059149

DomainStartEndE-ValueType
Pfam:MFS_1 21 396 4.2e-12 PFAM
transmembrane domain 398 420 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146267
SMART Domains Protein: ENSMUSP00000117864
Gene: ENSMUSG00000059149

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
transmembrane domain 55 74 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159038
AA Change: Y508C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125558
Gene: ENSMUSG00000059149
AA Change: Y508C

DomainStartEndE-ValueType
Pfam:MFS_1 20 395 6.8e-12 PFAM
transmembrane domain 398 420 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159382
Predicted Effect probably benign
Transcript: ENSMUST00000160656
SMART Domains Protein: ENSMUSP00000125138
Gene: ENSMUSG00000059149

DomainStartEndE-ValueType
transmembrane domain 2 20 N/A INTRINSIC
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 85 104 N/A INTRINSIC
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
transmembrane domain 292 314 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
transmembrane domain 354 376 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161864
AA Change: Y424C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124961
Gene: ENSMUSG00000059149
AA Change: Y424C

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
transmembrane domain 55 74 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 107 126 N/A INTRINSIC
Pfam:MFS_1 218 420 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189227
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C T 11: 78,273,270 Q40* probably null Het
Abcc9 A G 6: 142,604,828 probably null Het
Acsm3 C A 7: 119,775,234 T303N probably benign Het
Adamts13 A T 2: 26,986,591 R506W probably damaging Het
Adck5 C T 15: 76,593,585 T166M probably damaging Het
Adcy8 T A 15: 64,815,417 I413F probably damaging Het
Adgrl2 A T 3: 148,859,175 D252E probably damaging Het
Aldh16a1 T A 7: 45,144,545 T636S probably benign Het
Ampd1 C A 3: 103,090,075 F264L probably damaging Het
Arhgap17 T C 7: 123,286,758 probably benign Het
Babam2 A G 5: 32,064,807 probably benign Het
Bod1l T A 5: 41,820,578 E1131V probably benign Het
Cbs C T 17: 31,613,219 V553M probably damaging Het
Cd72 T C 4: 43,454,475 K18R probably damaging Het
Cep89 A G 7: 35,429,162 Y580C probably damaging Het
Chrnb1 T A 11: 69,792,729 I264F possibly damaging Het
Cntf A G 19: 12,763,993 W168R probably damaging Het
Cxxc1 T A 18: 74,221,166 D648E possibly damaging Het
Cyp2c68 A T 19: 39,712,492 L294Q probably damaging Het
Dab2ip T C 2: 35,715,402 S532P probably damaging Het
Defb3 G A 8: 19,295,184 C52Y probably damaging Het
Dennd5a T G 7: 109,934,221 E114A probably benign Het
Dnah12 T C 14: 26,706,884 F222L probably benign Het
Dock9 A C 14: 121,668,408 probably null Het
Fras1 A T 5: 96,645,948 H1043L probably benign Het
Gamt C A 10: 80,259,907 R63L possibly damaging Het
Gm1527 A G 3: 28,915,395 H298R probably benign Het
Gphb5 C T 12: 75,415,822 probably null Het
Greb1 A T 12: 16,733,421 V104D possibly damaging Het
Hck A G 2: 153,129,076 D86G probably damaging Het
Jhy T A 9: 40,922,662 K321* probably null Het
Kcna5 C T 6: 126,534,736 R143H probably damaging Het
Kif19a G T 11: 114,789,438 W867L possibly damaging Het
Map3k4 G A 17: 12,271,416 A376V probably damaging Het
Mars A T 10: 127,298,045 M661K probably benign Het
Mecp2 C T X: 74,035,437 V496M probably damaging Het
Mfsd2b A T 12: 4,867,651 C132S probably damaging Het
Mif4gd G T 11: 115,609,362 A89E probably benign Het
Mkln1 A T 6: 31,490,547 E593D probably benign Het
Mlh1 G T 9: 111,228,495 N749K possibly damaging Het
Mrgprb2 T A 7: 48,551,959 *339C probably null Het
Nphp4 T C 4: 152,547,079 V812A probably benign Het
Nrcam G T 12: 44,576,771 V1048L probably benign Het
Obsl1 G A 1: 75,493,859 A856V probably damaging Het
Osgepl1 T A 1: 53,318,167 F163I probably damaging Het
Pcdha6 C A 18: 36,969,068 T438K possibly damaging Het
Pcdhb20 A T 18: 37,505,233 M271L probably benign Het
Phip T C 9: 82,906,952 T770A probably benign Het
Ppm1d A G 11: 85,326,908 T166A probably damaging Het
Ptprf A T 4: 118,224,735 I1102K probably benign Het
Sbsn T C 7: 30,753,267 V569A possibly damaging Het
Skida1 T A 2: 18,046,003 probably benign Het
Smg1 T A 7: 118,190,586 probably benign Het
Sorcs2 A G 5: 36,229,191 Y168H probably damaging Het
Sufu A T 19: 46,454,733 probably null Het
Tbc1d24 A T 17: 24,185,526 W215R probably damaging Het
Tenm4 T C 7: 96,902,860 L2502P probably damaging Het
Tgm4 A T 9: 123,061,638 E10V probably damaging Het
Trip11 T C 12: 101,885,972 E611G probably damaging Het
Ttn C A 2: 76,709,899 A34248S possibly damaging Het
Ube3a T A 7: 59,272,028 N49K probably damaging Het
Ube3c A G 5: 29,658,292 D855G possibly damaging Het
Ugt8a A G 3: 125,875,553 S301P probably benign Het
Wdfy4 T A 14: 33,102,577 N1295I possibly damaging Het
Wdr47 G T 3: 108,610,012 G43C probably damaging Het
Wdtc1 A C 4: 133,294,362 L601W unknown Het
Zfp236 A G 18: 82,640,151 F614S possibly damaging Het
Zfp637 T A 6: 117,845,086 D58E possibly damaging Het
Other mutations in Mfsd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Mfsd4a APN 1 132040594 missense probably benign 0.34
IGL01348:Mfsd4a APN 1 132067826 missense probably null 0.96
IGL01621:Mfsd4a APN 1 132054143 missense probably benign 0.16
IGL01934:Mfsd4a APN 1 132046311 missense probably damaging 1.00
IGL02429:Mfsd4a APN 1 132028499 missense probably benign
R0362:Mfsd4a UTSW 1 132059275 missense probably damaging 1.00
R0551:Mfsd4a UTSW 1 132041919 missense probably damaging 1.00
R1435:Mfsd4a UTSW 1 132067756 missense probably damaging 1.00
R1566:Mfsd4a UTSW 1 132059179 missense probably damaging 1.00
R1739:Mfsd4a UTSW 1 132067883 missense possibly damaging 0.85
R1793:Mfsd4a UTSW 1 132059339 missense probably damaging 0.98
R1799:Mfsd4a UTSW 1 132053596 missense possibly damaging 0.63
R2244:Mfsd4a UTSW 1 132028505 missense probably benign 0.09
R3870:Mfsd4a UTSW 1 132046353 missense probably damaging 0.99
R4177:Mfsd4a UTSW 1 132040557 missense probably damaging 0.99
R4330:Mfsd4a UTSW 1 132053553 missense possibly damaging 0.71
R4705:Mfsd4a UTSW 1 132053571 missense probably damaging 1.00
R4717:Mfsd4a UTSW 1 132057895 missense probably benign 0.00
R5886:Mfsd4a UTSW 1 132067727 missense probably damaging 0.96
R7092:Mfsd4a UTSW 1 132067663 missense probably benign 0.06
R7189:Mfsd4a UTSW 1 132052393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTTTAGCCCATGCGTGG -3'
(R):5'- CTATGAGACTGTGGCTGTACG -3'

Sequencing Primer
(F):5'- GTGCGGGCTGTCTTTCATCC -3'
(R):5'- TGTACGTGTGCCCTAGTGCAC -3'
Posted On2017-02-15